EMAIL THIS PAGE TO A FRIEND

VMP1

vacuole membrane protein 1

Synonyms: EPG3 TANGO5 TMEM49
UniProtKB ID: Q96GC9, Q9H0P4, Q9P089
Gene ID:
Mouse(75909) vacuole membrane protein 1
Rat(192129) vacuole membrane protein 1
Zebrafish(336789) vacuole membrane protein 1
domestic cat(101080842) vacuole membrane protein 1
Horse(100057406) vacuole membrane protein 1
dog(491120) vacuole membrane protein 1
chicken(417635) vacuole membrane protein 1
naked mole-rat(101721487) vacuole membrane protein 1
domestic guinea pig(100723727) vacuole membrane protein 1
cow(508631) vacuole membrane protein 1
sheep(101104918) vacuole membrane protein 1
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030938 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047551 MISSION® esiRNA esiRNA human TMEM49 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030938 Rosetta Predictions human pricing
NM_138839 Rosetta Predictions rat pricing
NM_029478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092297 predicted 1395
2 SASI_Hs01_00092298 predicted 672
3 SASI_Hs01_00092299 predicted 718
4 SASI_Hs01_00092300 predicted 1189
5 SASI_Hs01_00092301 predicted 546
6 SASI_Hs01_00092302 predicted 1391
7 SASI_Hs01_00092303 predicted 767
8 SASI_Hs02_00358512 predicted 392
9 SASI_Hs02_00358513 predicted 320
10 SASI_Hs01_00092305 predicted 695
11 SASI_Hs01_00092304 predicted 1062
12 SASI_Hs01_00092306 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043287 predicted 510
2 SASI_Rn02_00268219 predicted 1232
3 SASI_Rn02_00268220 predicted 417
4 SASI_Rn01_00043289 predicted 1192
5 SASI_Rn01_00043290 predicted 633
6 SASI_Rn01_00043291 predicted 408
7 SASI_Rn01_00043292 predicted 546
8 SASI_Rn01_00043293 predicted 1247
9 SASI_Rn01_00043294 predicted 371
10 SASI_Rn01_00043295 predicted 469
11 SASI_Rn01_00043288 predicted 1033
12 SASI_Rn01_00043296 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028652 predicted 511
2 SASI_Mm01_00028653 predicted 1196
3 SASI_Mm01_00028654 predicted 1240
4 SASI_Mm01_00028655 predicted 926
5 SASI_Mm01_00028656 predicted 506
6 SASI_Mm01_00028657 predicted 1219
7 SASI_Mm01_00028658 predicted 1371
8 SASI_Mm01_00028660 predicted 549
9 SASI_Mm01_00028661 predicted 951
10 SASI_Mm02_00335413 predicted 420
11 SASI_Mm01_00028659 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030938
VALIDATED
VMP1 MISSION shRNA Bacterial Glycerol Stock
vacuole membrane protein 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-571s21c1
Sequence:CCGGCAACAGTATGTGCAACGTATACTCGAGTATACGTTGCACATACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-535s21c1
Sequence:CCGGGTGCTTATAGCTACGTATTATCTCGAGATAATACGTAGCTATAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-313s21c1
Sequence:CCGGGCAATGAACAAGGAACATCATCTCGAGATGATGTTCCTTGTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-1688s21c1
Sequence:CCGGCGATGCAATCCACCTTGTGTTCTCGAGAACACAAGGTGGATTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030938.2-1051s1c1
Sequence:CCGGGCAAGCACATAGTGGAGCAAACTCGAGTTTGCTCCACTATGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030938.2-919s1c1
Sequence:CCGGCTTTATTTGATCTGGCTGGAACTCGAGTTCCAGCCAGATCAAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030938.2-1528s1c1
Sequence:CCGGCGATGCAATCCACCTTGTGTTCTCGAGAACACAAGGTGGATTGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030938.2-2270s1c1
Sequence:CCGGGAAAGGATACTGGAGAGAGAACTCGAGTTCTCTCTCCAGTATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030938.2-1698s1c1
Sequence:CCGGGCTTGTCACAAATGATTGCTTCTCGAGAAGCAATCATTTGTGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030938.2-150s1c1
Sequence:CCGGGTAGCAATGAACAAGGAACATCTCGAGATGTTCCTTGTTCATTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030938.2-542s1c1
Sequence:CCGGCTCAGTTACATTAGCTGCTTACTCGAGTAAGCAGCTAATGTAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_030938.2-411s1c1
Sequence:CCGGCAACAGTATGTGCAACGTATACTCGAGTATACGTTGCACATACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_030938.2-153s1c1
Sequence:CCGGGCAATGAACAAGGAACATCATCTCGAGATGATGTTCCTTGTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030938
VALIDATED
VMP1 MISSION shRNA shRNA Plasmid DNA
vacuole membrane protein 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-571s21c1
Sequence:CCGGCAACAGTATGTGCAACGTATACTCGAGTATACGTTGCACATACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-535s21c1
Sequence:CCGGGTGCTTATAGCTACGTATTATCTCGAGATAATACGTAGCTATAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-313s21c1
Sequence:CCGGGCAATGAACAAGGAACATCATCTCGAGATGATGTTCCTTGTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-1688s21c1
Sequence:CCGGCGATGCAATCCACCTTGTGTTCTCGAGAACACAAGGTGGATTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030938.2-1051s1c1
Sequence:CCGGGCAAGCACATAGTGGAGCAAACTCGAGTTTGCTCCACTATGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030938.2-919s1c1
Sequence:CCGGCTTTATTTGATCTGGCTGGAACTCGAGTTCCAGCCAGATCAAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030938.2-1528s1c1
Sequence:CCGGCGATGCAATCCACCTTGTGTTCTCGAGAACACAAGGTGGATTGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030938.2-2270s1c1
Sequence:CCGGGAAAGGATACTGGAGAGAGAACTCGAGTTCTCTCTCCAGTATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030938.2-1698s1c1
Sequence:CCGGGCTTGTCACAAATGATTGCTTCTCGAGAAGCAATCATTTGTGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030938.2-150s1c1
Sequence:CCGGGTAGCAATGAACAAGGAACATCTCGAGATGTTCCTTGTTCATTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030938.2-542s1c1
Sequence:CCGGCTCAGTTACATTAGCTGCTTACTCGAGTAAGCAGCTAATGTAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_030938.2-411s1c1
Sequence:CCGGCAACAGTATGTGCAACGTATACTCGAGTATACGTTGCACATACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_030938.2-153s1c1
Sequence:CCGGGCAATGAACAAGGAACATCATCTCGAGATGATGTTCCTTGTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030938
VALIDATED
VMP1 MISSION shRNA Lentiviral Transduction Particles
vacuole membrane protein 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-571s21c1
Sequence:CCGGCAACAGTATGTGCAACGTATACTCGAGTATACGTTGCACATACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-535s21c1
Sequence:CCGGGTGCTTATAGCTACGTATTATCTCGAGATAATACGTAGCTATAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-313s21c1
Sequence:CCGGGCAATGAACAAGGAACATCATCTCGAGATGATGTTCCTTGTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_030938.3-1688s21c1
Sequence:CCGGCGATGCAATCCACCTTGTGTTCTCGAGAACACAAGGTGGATTGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030938.2-1051s1c1
Sequence:CCGGGCAAGCACATAGTGGAGCAAACTCGAGTTTGCTCCACTATGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030938.2-919s1c1
Sequence:CCGGCTTTATTTGATCTGGCTGGAACTCGAGTTCCAGCCAGATCAAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030938.2-1528s1c1
Sequence:CCGGCGATGCAATCCACCTTGTGTTCTCGAGAACACAAGGTGGATTGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030938.2-2270s1c1
Sequence:CCGGGAAAGGATACTGGAGAGAGAACTCGAGTTCTCTCTCCAGTATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030938.2-1698s1c1
Sequence:CCGGGCTTGTCACAAATGATTGCTTCTCGAGAAGCAATCATTTGTGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030938.2-150s1c1
Sequence:CCGGGTAGCAATGAACAAGGAACATCTCGAGATGTTCCTTGTTCATTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030938.2-542s1c1
Sequence:CCGGCTCAGTTACATTAGCTGCTTACTCGAGTAAGCAGCTAATGTAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_030938.2-411s1c1
Sequence:CCGGCAACAGTATGTGCAACGTATACTCGAGTATACGTTGCACATACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_030938.2-153s1c1
Sequence:CCGGGCAATGAACAAGGAACATCATCTCGAGATGATGTTCCTTGTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029478
VALIDATED
VMP1 MISSION shRNA Bacterial Glycerol Stock
vacuole membrane protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-1469s21c1
Sequence:CCGGATGTTACACTGACATACTTTACTCGAGTAAAGTATGTCAGTGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-590s21c1
Sequence:CCGGCCCTATCCTGACCAGATTATCCTCGAGGATAATCTGGTCAGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-952s21c1
Sequence:CCGGCCTTGTACCTTTCTGGACCTTCTCGAGAAGGTCCAGAAAGGTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029478.3-988s1c1
Sequence:CCGGGATTGGGAAAGCAATCATTAACTCGAGTTAATGATTGCTTTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-372s21c1
Sequence:CCGGCGCTTGTAGCTACGTATTATGCTCGAGCATAATACGTAGCTACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-1249s21c1
Sequence:CCGGCCTGTCTATTATTAACTCCATCTCGAGATGGAGTTAATAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029478.2-2494s1c1
Sequence:CCGGCGGATAGCTTATCAGACTGATCTCGAGATCAGTCTGATAAGCTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029478.2-1250s1c1
Sequence:CCGGCCTGTCTATTATTAACTCCATCTCGAGATGGAGTTAATAATAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029478.2-953s1c1
Sequence:CCGGCCTTGTACCTTTCTGGACCTTCTCGAGAAGGTCCAGAAAGGTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029478.2-1652s1c1
Sequence:CCGGGCTTGTCACAAATGATTGTTTCTCGAGAAACAATCATTTGTGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029478
VALIDATED
VMP1 MISSION shRNA shRNA Plasmid DNA
vacuole membrane protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-1469s21c1
Sequence:CCGGATGTTACACTGACATACTTTACTCGAGTAAAGTATGTCAGTGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-590s21c1
Sequence:CCGGCCCTATCCTGACCAGATTATCCTCGAGGATAATCTGGTCAGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-952s21c1
Sequence:CCGGCCTTGTACCTTTCTGGACCTTCTCGAGAAGGTCCAGAAAGGTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029478.3-988s1c1
Sequence:CCGGGATTGGGAAAGCAATCATTAACTCGAGTTAATGATTGCTTTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-372s21c1
Sequence:CCGGCGCTTGTAGCTACGTATTATGCTCGAGCATAATACGTAGCTACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-1249s21c1
Sequence:CCGGCCTGTCTATTATTAACTCCATCTCGAGATGGAGTTAATAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029478.2-2494s1c1
Sequence:CCGGCGGATAGCTTATCAGACTGATCTCGAGATCAGTCTGATAAGCTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029478.2-1250s1c1
Sequence:CCGGCCTGTCTATTATTAACTCCATCTCGAGATGGAGTTAATAATAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029478.2-953s1c1
Sequence:CCGGCCTTGTACCTTTCTGGACCTTCTCGAGAAGGTCCAGAAAGGTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029478.2-1652s1c1
Sequence:CCGGGCTTGTCACAAATGATTGTTTCTCGAGAAACAATCATTTGTGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029478
VALIDATED
VMP1 MISSION shRNA Lentiviral Transduction Particles
vacuole membrane protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-1469s21c1
Sequence:CCGGATGTTACACTGACATACTTTACTCGAGTAAAGTATGTCAGTGTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-590s21c1
Sequence:CCGGCCCTATCCTGACCAGATTATCCTCGAGGATAATCTGGTCAGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-952s21c1
Sequence:CCGGCCTTGTACCTTTCTGGACCTTCTCGAGAAGGTCCAGAAAGGTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029478.3-988s1c1
Sequence:CCGGGATTGGGAAAGCAATCATTAACTCGAGTTAATGATTGCTTTCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-372s21c1
Sequence:CCGGCGCTTGTAGCTACGTATTATGCTCGAGCATAATACGTAGCTACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029478.3-1249s21c1
Sequence:CCGGCCTGTCTATTATTAACTCCATCTCGAGATGGAGTTAATAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029478.2-2494s1c1
Sequence:CCGGCGGATAGCTTATCAGACTGATCTCGAGATCAGTCTGATAAGCTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029478.2-1250s1c1
Sequence:CCGGCCTGTCTATTATTAACTCCATCTCGAGATGGAGTTAATAATAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029478.2-953s1c1
Sequence:CCGGCCTTGTACCTTTCTGGACCTTCTCGAGAAGGTCCAGAAAGGTACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193479    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029478.2-1652s1c1
Sequence:CCGGGCTTGTCACAAATGATTGTTTCTCGAGAAACAATCATTTGTGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks