EMAIL THIS PAGE TO A FRIEND

VN1R17P

vomeronasal 1 receptor 17 pseudogene

Synonyms: GPCR
Species: Human VN1R17P(441931)
UniProtKB ID: Q8TDU5
Gene ID:
10 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025075 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003134 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378382 predicted 206
2 SASI_Hs02_00378383 predicted 373
3 SASI_Hs02_00378384 predicted 211
4 SASI_Hs02_00378385 predicted 370
5 SASI_Hs02_00378386 predicted 209
6 SASI_Hs02_00378387 predicted 228
7 SASI_Hs02_00378388 predicted 306
8 SASI_Hs02_00378389 predicted 198
9 SASI_Hs02_00378390 predicted 239
10 SASI_Hs02_00378391 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025075
VN1R17P MISSION shRNA Bacterial Glycerol Stock
vomeronasal 1 receptor 17 pseudogene
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-126s1c1
Sequence:CCGGCAGGCTTAAGCCCATTGACATCTCGAGATGTCAATGGGCTTAAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-136s1c1
Sequence:CCGGCCCATTGACATGACCATTAGTCTCGAGACTAATGGTCATGTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-165s1c1
Sequence:CCGGCCTAATCCACATACTGCTACTCTCGAGAGTAGCAGTATGTGGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-60s1c1
Sequence:CCGGCAGCTTTGGAATCTCAGCAAACTCGAGTTTGCTGAGATTCCAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-172s1c1
Sequence:CCGGCACATACTGCTACTCTTCACTCTCGAGAGTGAAGAGTAGCAGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025075.1-77s1c1
Sequence:CCGGCAAACACCTTCCTCCTTCTTTCTCGAGAAAGAAGGAGGAAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025075
VN1R17P MISSION shRNA shRNA Plasmid DNA
vomeronasal 1 receptor 17 pseudogene
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-126s1c1
Sequence:CCGGCAGGCTTAAGCCCATTGACATCTCGAGATGTCAATGGGCTTAAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-136s1c1
Sequence:CCGGCCCATTGACATGACCATTAGTCTCGAGACTAATGGTCATGTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-165s1c1
Sequence:CCGGCCTAATCCACATACTGCTACTCTCGAGAGTAGCAGTATGTGGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-60s1c1
Sequence:CCGGCAGCTTTGGAATCTCAGCAAACTCGAGTTTGCTGAGATTCCAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-172s1c1
Sequence:CCGGCACATACTGCTACTCTTCACTCTCGAGAGTGAAGAGTAGCAGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025075.1-77s1c1
Sequence:CCGGCAAACACCTTCCTCCTTCTTTCTCGAGAAAGAAGGAGGAAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025075
VN1R17P MISSION shRNA Lentiviral Transduction Particles
vomeronasal 1 receptor 17 pseudogene
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-126s1c1
Sequence:CCGGCAGGCTTAAGCCCATTGACATCTCGAGATGTCAATGGGCTTAAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-136s1c1
Sequence:CCGGCCCATTGACATGACCATTAGTCTCGAGACTAATGGTCATGTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-165s1c1
Sequence:CCGGCCTAATCCACATACTGCTACTCTCGAGAGTAGCAGTATGTGGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-60s1c1
Sequence:CCGGCAGCTTTGGAATCTCAGCAAACTCGAGTTTGCTGAGATTCCAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025075.1-172s1c1
Sequence:CCGGCACATACTGCTACTCTTCACTCTCGAGAGTGAAGAGTAGCAGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025075.1-77s1c1
Sequence:CCGGCAAACACCTTCCTCCTTCTTTCTCGAGAAAGAAGGAGGAAGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks