EMAIL THIS PAGE TO A FRIEND

VN1R1

vomeronasal 1 receptor 1

Synonyms: V1RL1 VNR19I1 ZVNH1 ZVNR1
UniProtKB ID: Q9GZP7, B3KSV5, Q7Z5H8, Q7Z5H9
Gene ID:
Human(57191) Summary: Pheromones are chemical signals that elicit specific behavioral responses and physiologic alterations in recipients of the same species. The protein encoded by this gene is similar to pheromone receptors and is primarily localized to the olfactory mucosa. An alternate splice variant of this gene is thought to exist, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
cow(790265) vomeronasal 1 receptor 1
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020633 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054921 MISSION® esiRNA esiRNA human VN1R1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020633 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217114 predicted 646
2 SASI_Hs01_00217115 predicted 870
3 SASI_Hs02_00353610 predicted 982
4 SASI_Hs01_00217117 predicted 633
5 SASI_Hs01_00217118 predicted 1045
6 SASI_Hs01_00217119 predicted 1085
7 SASI_Hs01_00217120 predicted 738
8 SASI_Hs02_00353611 predicted 429
9 SASI_Hs01_00217121 predicted 330
10 SASI_Hs01_00217122 predicted 632
11 SASI_Hs01_00217113 predicted 428
12 SASI_Hs01_00217116 predicted 970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020633
VN1R1 MISSION shRNA Bacterial Glycerol Stock
vomeronasal 1 receptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-34s1c1
Sequence:CCGGCTGATGACAAGATACTTCTTTCTCGAGAAAGAAGTATCTTGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020633.2-1100s1c1
Sequence:CCGGCTCTTGCTAAGATTTAGGAAACTCGAGTTTCCTAAATCTTAGCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-1035s1c1
Sequence:CCGGCTTTCCTAATCTGGTTGTCATCTCGAGATGACAACCAGATTAGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-874s1c1
Sequence:CCGGCTGACAATTTGGACAACTGTACTCGAGTACAGTTGTCCAAATTGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-413s1c1
Sequence:CCGGCCATCTGCCTTCTCAATGGATCTCGAGATCCATTGAGAAGGCAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020633.2-467s21c1
Sequence:CCGGGGTGGATGGAGATCAAGATTACTCGAGTAATCTTGATCTCCATCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020633.2-548s21c1
Sequence:CCGGATGCATCTGTTCTTCTATTAGCTCGAGCTAATAGAAGAACAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020633.2-1102s21c1
Sequence:CCGGCTTGCTAAGATTTAGGAAATACTCGAGTATTTCCTAAATCTTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020633.2-650s21c1
Sequence:CCGGGCTCATTACATGCAGTCTTATCTCGAGATAAGACTGCATGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020633
VN1R1 MISSION shRNA shRNA Plasmid DNA
vomeronasal 1 receptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-34s1c1
Sequence:CCGGCTGATGACAAGATACTTCTTTCTCGAGAAAGAAGTATCTTGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020633.2-1100s1c1
Sequence:CCGGCTCTTGCTAAGATTTAGGAAACTCGAGTTTCCTAAATCTTAGCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-1035s1c1
Sequence:CCGGCTTTCCTAATCTGGTTGTCATCTCGAGATGACAACCAGATTAGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-874s1c1
Sequence:CCGGCTGACAATTTGGACAACTGTACTCGAGTACAGTTGTCCAAATTGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-413s1c1
Sequence:CCGGCCATCTGCCTTCTCAATGGATCTCGAGATCCATTGAGAAGGCAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020633.2-467s21c1
Sequence:CCGGGGTGGATGGAGATCAAGATTACTCGAGTAATCTTGATCTCCATCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020633.2-548s21c1
Sequence:CCGGATGCATCTGTTCTTCTATTAGCTCGAGCTAATAGAAGAACAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020633.2-1102s21c1
Sequence:CCGGCTTGCTAAGATTTAGGAAATACTCGAGTATTTCCTAAATCTTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020633.2-650s21c1
Sequence:CCGGGCTCATTACATGCAGTCTTATCTCGAGATAAGACTGCATGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020633
VN1R1 MISSION shRNA Lentiviral Transduction Particles
vomeronasal 1 receptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-34s1c1
Sequence:CCGGCTGATGACAAGATACTTCTTTCTCGAGAAAGAAGTATCTTGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020633.2-1100s1c1
Sequence:CCGGCTCTTGCTAAGATTTAGGAAACTCGAGTTTCCTAAATCTTAGCAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-1035s1c1
Sequence:CCGGCTTTCCTAATCTGGTTGTCATCTCGAGATGACAACCAGATTAGGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-874s1c1
Sequence:CCGGCTGACAATTTGGACAACTGTACTCGAGTACAGTTGTCCAAATTGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020633.2-413s1c1
Sequence:CCGGCCATCTGCCTTCTCAATGGATCTCGAGATCCATTGAGAAGGCAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020633.2-467s21c1
Sequence:CCGGGGTGGATGGAGATCAAGATTACTCGAGTAATCTTGATCTCCATCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020633.2-548s21c1
Sequence:CCGGATGCATCTGTTCTTCTATTAGCTCGAGCTAATAGAAGAACAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020633.2-1102s21c1
Sequence:CCGGCTTGCTAAGATTTAGGAAATACTCGAGTATTTCCTAAATCTTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020633.2-650s21c1
Sequence:CCGGGCTCATTACATGCAGTCTTATCTCGAGATAAGACTGCATGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks