EMAIL THIS PAGE TO A FRIEND

VN1R2

vomeronasal 1 receptor 2

Synonyms: V1RL2
UniProtKB ID: Q8NFZ6, A1L411, Q8TDU4
Gene ID:
cow(100139430) vomeronasal 1 receptor 2
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173856 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136921 MISSION® esiRNA esiRNA human VN1R2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173856 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140309 predicted 867
2 SASI_Hs01_00140310 predicted 963
3 SASI_Hs01_00140312 predicted 700
4 SASI_Hs01_00140313 predicted 963
5 SASI_Hs02_00368733 predicted 1036
6 SASI_Hs02_00368734 predicted 1070
7 SASI_Hs01_00140315 predicted 764
8 SASI_Hs02_00368735 predicted 1019
9 SASI_Hs02_00368736 predicted 637
10 SASI_Hs02_00368737 predicted 1075
11 SASI_Hs01_00140307 predicted 871
12 SASI_Hs01_00140308 predicted 798
13 SASI_Hs01_00140311 predicted 969
14 SASI_Hs01_00140314 predicted 730
15 SASI_Hs01_00140316 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173856
VN1R2 MISSION shRNA Bacterial Glycerol Stock
vomeronasal 1 receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-652s1c1
Sequence:CCGGGCCTTCCACATGCTGGTAAATCTCGAGATTTACCAGCATGTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-682s1c1
Sequence:CCGGCCTATTTATACAACTGGCAAACTCGAGTTTGCCAGTTGTATAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-274s1c1
Sequence:CCGGCCTACACTATTCCAGGTAGTTCTCGAGAACTACCTGGAATAGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-360s1c1
Sequence:CCGGGCCAAGATCCACAGATTTGATCTCGAGATCAAATCTGTGGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-1002s1c1
Sequence:CCGGCTACGTTTATTTAGCTCTCTTCTCGAGAAGAGAGCTAAATAAACGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173856.2-1094s21c1
Sequence:CCGGATTTAGCTCTCTTCGATAATTCTCGAGAATTATCGAAGAGAGCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173856.2-490s21c1
Sequence:CCGGTCCTTGGTTATCCTATCTAAACTCGAGTTTAGATAGGATAACCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173856.2-810s21c1
Sequence:CCGGGAAAGGAGATTTGGGATATTGCTCGAGCAATATCCCAAATCTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173856
VN1R2 MISSION shRNA shRNA Plasmid DNA
vomeronasal 1 receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-652s1c1
Sequence:CCGGGCCTTCCACATGCTGGTAAATCTCGAGATTTACCAGCATGTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-682s1c1
Sequence:CCGGCCTATTTATACAACTGGCAAACTCGAGTTTGCCAGTTGTATAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-274s1c1
Sequence:CCGGCCTACACTATTCCAGGTAGTTCTCGAGAACTACCTGGAATAGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-360s1c1
Sequence:CCGGGCCAAGATCCACAGATTTGATCTCGAGATCAAATCTGTGGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-1002s1c1
Sequence:CCGGCTACGTTTATTTAGCTCTCTTCTCGAGAAGAGAGCTAAATAAACGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173856.2-1094s21c1
Sequence:CCGGATTTAGCTCTCTTCGATAATTCTCGAGAATTATCGAAGAGAGCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173856.2-490s21c1
Sequence:CCGGTCCTTGGTTATCCTATCTAAACTCGAGTTTAGATAGGATAACCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173856.2-810s21c1
Sequence:CCGGGAAAGGAGATTTGGGATATTGCTCGAGCAATATCCCAAATCTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173856
VN1R2 MISSION shRNA Lentiviral Transduction Particles
vomeronasal 1 receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-652s1c1
Sequence:CCGGGCCTTCCACATGCTGGTAAATCTCGAGATTTACCAGCATGTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-682s1c1
Sequence:CCGGCCTATTTATACAACTGGCAAACTCGAGTTTGCCAGTTGTATAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-274s1c1
Sequence:CCGGCCTACACTATTCCAGGTAGTTCTCGAGAACTACCTGGAATAGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-360s1c1
Sequence:CCGGGCCAAGATCCACAGATTTGATCTCGAGATCAAATCTGTGGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173856.1-1002s1c1
Sequence:CCGGCTACGTTTATTTAGCTCTCTTCTCGAGAAGAGAGCTAAATAAACGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173856.2-1094s21c1
Sequence:CCGGATTTAGCTCTCTTCGATAATTCTCGAGAATTATCGAAGAGAGCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173856.2-490s21c1
Sequence:CCGGTCCTTGGTTATCCTATCTAAACTCGAGTTTAGATAGGATAACCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173856.2-810s21c1
Sequence:CCGGGAAAGGAGATTTGGGATATTGCTCGAGCAATATCCCAAATCTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks