EMAIL THIS PAGE TO A FRIEND

VN1R3

vomeronasal 1 receptor 3 (gene/pseudogene)

Synonyms: V1RL3 V1RL3p
Species: Human VN1R3(317702)
UniProtKB ID: Q9BXE9
Gene ID:
4 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501412 Anti-VN1R3 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174980 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174980
VN1R3 MISSION shRNA Bacterial Glycerol Stock
vomeronasal 1 receptor 3 (gene/pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174980.1-950s1c1
Sequence:CCGGCCGATTTATGTGGATTGTCTTCTCGAGAAGACAATCCACATAAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-93s1c1
Sequence:CCGGCCACTATAGTTTCCTTTGTTTCTCGAGAAACAAAGGAAACTATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-763s1c1
Sequence:CCGGCCATCTTTACATATGTCTCTTCTCGAGAAGAGACATATGTAAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-198s1c1
Sequence:CCGGCCCACAAACAATGGCTGCTTTCTCGAGAAAGCAGCCATTGTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-234s1c1
Sequence:CCGGCCTCAGTGATATTGGATGCAACTCGAGTTGCATCCAATATCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174980
VN1R3 MISSION shRNA shRNA Plasmid DNA
vomeronasal 1 receptor 3 (gene/pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174980.1-950s1c1
Sequence:CCGGCCGATTTATGTGGATTGTCTTCTCGAGAAGACAATCCACATAAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-93s1c1
Sequence:CCGGCCACTATAGTTTCCTTTGTTTCTCGAGAAACAAAGGAAACTATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-763s1c1
Sequence:CCGGCCATCTTTACATATGTCTCTTCTCGAGAAGAGACATATGTAAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-198s1c1
Sequence:CCGGCCCACAAACAATGGCTGCTTTCTCGAGAAAGCAGCCATTGTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-234s1c1
Sequence:CCGGCCTCAGTGATATTGGATGCAACTCGAGTTGCATCCAATATCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174980
VN1R3 MISSION shRNA Lentiviral Transduction Particles
vomeronasal 1 receptor 3 (gene/pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174980.1-950s1c1
Sequence:CCGGCCGATTTATGTGGATTGTCTTCTCGAGAAGACAATCCACATAAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-93s1c1
Sequence:CCGGCCACTATAGTTTCCTTTGTTTCTCGAGAAACAAAGGAAACTATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-763s1c1
Sequence:CCGGCCATCTTTACATATGTCTCTTCTCGAGAAGAGACATATGTAAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-198s1c1
Sequence:CCGGCCCACAAACAATGGCTGCTTTCTCGAGAAAGCAGCCATTGTTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174980.1-234s1c1
Sequence:CCGGCCTCAGTGATATTGGATGCAACTCGAGTTGCATCCAATATCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks