EMAIL THIS PAGE TO A FRIEND

VN1R4

vomeronasal 1 receptor 4

Synonyms: V1RL4
UniProtKB ID: Q7Z5H5, Q2M3E2, Q7Z5H6, Q7Z5H7, Q8TDU2
Gene ID:
dog(484322) vomeronasal 1 receptor 4
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173857 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020651 MISSION® esiRNA esiRNA human VN1R4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173857 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185169 predicted 528
2 SASI_Hs01_00185170 predicted 408
3 SASI_Hs01_00185171 predicted 479
4 SASI_Hs01_00185172 predicted 428
5 SASI_Hs01_00185173 predicted 482
6 SASI_Hs01_00185174 predicted 334
7 SASI_Hs01_00185175 predicted 220
8 SASI_Hs01_00185176 predicted 399
9 SASI_Hs01_00185177 predicted 598
10 SASI_Hs02_00368738 predicted 399
11 SASI_Hs01_00185168 predicted 522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173857
VN1R4 MISSION shRNA Bacterial Glycerol Stock
vomeronasal 1 receptor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-436s1c1
Sequence:CCGGCCCATGTATGTGACTGGCAAACTCGAGTTTGCCAGTCACATACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-141s1c1
Sequence:CCGGGCACCTGATTGTAGCCAACTTCTCGAGAAGTTGGCTACAATCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-408s1c1
Sequence:CCGGCGTGTGCATGTTGGTAAACATCTCGAGATGTTTACCAACATGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-120s1c1
Sequence:CCGGGTCCACAGATTTGATTGTTAACTCGAGTTAACAATCAAATCTGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-640s1c1
Sequence:CCGGCAGCACATTGATAGGAGCGATCTCGAGATCGCTCCTATCAATGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-471s21c1
Sequence:CCGGCATCACAGTGAACGAGGATTTCTCGAGAAATCCTCGTTCACTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-160s21c1
Sequence:CCGGTTCTTAGCTCTCCGCTGTAAACTCGAGTTTACAGCGGAGAGCTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-538s21c1
Sequence:CCGGCGTGCAATGTTGTTATCATTCCTCGAGGAATGATAACAACATTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-405s21c1
Sequence:CCGGGATCGTGTGCATGTTGGTAAACTCGAGTTTACCAACATGCACACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173857
VN1R4 MISSION shRNA shRNA Plasmid DNA
vomeronasal 1 receptor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-436s1c1
Sequence:CCGGCCCATGTATGTGACTGGCAAACTCGAGTTTGCCAGTCACATACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-141s1c1
Sequence:CCGGGCACCTGATTGTAGCCAACTTCTCGAGAAGTTGGCTACAATCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-408s1c1
Sequence:CCGGCGTGTGCATGTTGGTAAACATCTCGAGATGTTTACCAACATGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-120s1c1
Sequence:CCGGGTCCACAGATTTGATTGTTAACTCGAGTTAACAATCAAATCTGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-640s1c1
Sequence:CCGGCAGCACATTGATAGGAGCGATCTCGAGATCGCTCCTATCAATGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-471s21c1
Sequence:CCGGCATCACAGTGAACGAGGATTTCTCGAGAAATCCTCGTTCACTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-160s21c1
Sequence:CCGGTTCTTAGCTCTCCGCTGTAAACTCGAGTTTACAGCGGAGAGCTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-538s21c1
Sequence:CCGGCGTGCAATGTTGTTATCATTCCTCGAGGAATGATAACAACATTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-405s21c1
Sequence:CCGGGATCGTGTGCATGTTGGTAAACTCGAGTTTACCAACATGCACACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173857
VN1R4 MISSION shRNA Lentiviral Transduction Particles
vomeronasal 1 receptor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-436s1c1
Sequence:CCGGCCCATGTATGTGACTGGCAAACTCGAGTTTGCCAGTCACATACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-141s1c1
Sequence:CCGGGCACCTGATTGTAGCCAACTTCTCGAGAAGTTGGCTACAATCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-408s1c1
Sequence:CCGGCGTGTGCATGTTGGTAAACATCTCGAGATGTTTACCAACATGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-120s1c1
Sequence:CCGGGTCCACAGATTTGATTGTTAACTCGAGTTAACAATCAAATCTGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173857.1-640s1c1
Sequence:CCGGCAGCACATTGATAGGAGCGATCTCGAGATCGCTCCTATCAATGTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-471s21c1
Sequence:CCGGCATCACAGTGAACGAGGATTTCTCGAGAAATCCTCGTTCACTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-160s21c1
Sequence:CCGGTTCTTAGCTCTCCGCTGTAAACTCGAGTTTACAGCGGAGAGCTAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-538s21c1
Sequence:CCGGCGTGCAATGTTGTTATCATTCCTCGAGGAATGATAACAACATTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173857.2-405s21c1
Sequence:CCGGGATCGTGTGCATGTTGGTAAACTCGAGTTTACCAACATGCACACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks