EMAIL THIS PAGE TO A FRIEND

VN1R5

vomeronasal 1 receptor 5 (gene/pseudogene)

Synonyms: V1RL5
Species: Human VN1R5(317705)
UniProtKB ID: Q7Z5H4, A0AVG1, Q8NEU5, Q8TDU3
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173858 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173858 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368739 predicted 308
2 SASI_Hs01_00059068 predicted 293
3 SASI_Hs01_00059070 predicted 734
4 SASI_Hs01_00059071 predicted 293
5 SASI_Hs01_00059072 predicted 702
6 SASI_Hs01_00059073 predicted 462
7 SASI_Hs01_00059074 predicted 341
8 SASI_Hs01_00059075 predicted 334
9 SASI_Hs01_00059076 predicted 457
10 SASI_Hs01_00059077 predicted 521
11 SASI_Hs01_00059069 predicted 484
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173858
VN1R5 MISSION shRNA Bacterial Glycerol Stock
vomeronasal 1 receptor 5 (gene/pseudogene)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173858.1-336s21c1
Sequence:CCGGTCAGGATGATCTTAGGTATAACTCGAGTTATACCTAAGATCATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173858.1-847s21c1
Sequence:CCGGGTGGACTTTACGTTCTCATTTCTCGAGAAATGAGAACGTAAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173858.1-233s21c1
Sequence:CCGGAGTCCATTGACATGATAATTACTCGAGTAATTATCATGTCAATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-158s1c1
Sequence:CCGGCCAGCTTTGGAATTTCAGCAACTCGAGTTGCTGAAATTCCAAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-704s1c1
Sequence:CCGGAGAGGCTACATGGTGATTATTCTCGAGAATAATCACCATGTAGCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-27s1c1
Sequence:CCGGCATGGCAGAAATTATGCTATTCTCGAGAATAGCATAATTTCTGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-834s1c1
Sequence:CCGGCTTCACATACTGGGTGGACTTCTCGAGAAGTCCACCCAGTATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-335s1c1
Sequence:CCGGCTCAGGATGATCTTAGGTATACTCGAGTATACCTAAGATCATCCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173858
VN1R5 MISSION shRNA shRNA Plasmid DNA
vomeronasal 1 receptor 5 (gene/pseudogene)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173858.1-336s21c1
Sequence:CCGGTCAGGATGATCTTAGGTATAACTCGAGTTATACCTAAGATCATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173858.1-847s21c1
Sequence:CCGGGTGGACTTTACGTTCTCATTTCTCGAGAAATGAGAACGTAAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173858.1-233s21c1
Sequence:CCGGAGTCCATTGACATGATAATTACTCGAGTAATTATCATGTCAATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-158s1c1
Sequence:CCGGCCAGCTTTGGAATTTCAGCAACTCGAGTTGCTGAAATTCCAAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-704s1c1
Sequence:CCGGAGAGGCTACATGGTGATTATTCTCGAGAATAATCACCATGTAGCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-27s1c1
Sequence:CCGGCATGGCAGAAATTATGCTATTCTCGAGAATAGCATAATTTCTGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-834s1c1
Sequence:CCGGCTTCACATACTGGGTGGACTTCTCGAGAAGTCCACCCAGTATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-335s1c1
Sequence:CCGGCTCAGGATGATCTTAGGTATACTCGAGTATACCTAAGATCATCCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173858
VN1R5 MISSION shRNA Lentiviral Transduction Particles
vomeronasal 1 receptor 5 (gene/pseudogene)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173858.1-336s21c1
Sequence:CCGGTCAGGATGATCTTAGGTATAACTCGAGTTATACCTAAGATCATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173858.1-847s21c1
Sequence:CCGGGTGGACTTTACGTTCTCATTTCTCGAGAAATGAGAACGTAAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173858.1-233s21c1
Sequence:CCGGAGTCCATTGACATGATAATTACTCGAGTAATTATCATGTCAATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-158s1c1
Sequence:CCGGCCAGCTTTGGAATTTCAGCAACTCGAGTTGCTGAAATTCCAAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-704s1c1
Sequence:CCGGAGAGGCTACATGGTGATTATTCTCGAGAATAATCACCATGTAGCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-27s1c1
Sequence:CCGGCATGGCAGAAATTATGCTATTCTCGAGAATAGCATAATTTCTGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-834s1c1
Sequence:CCGGCTTCACATACTGGGTGGACTTCTCGAGAAGTCCACCCAGTATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173858.1-335s1c1
Sequence:CCGGCTCAGGATGATCTTAGGTATACTCGAGTATACCTAAGATCATCCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks