EMAIL THIS PAGE TO A FRIEND

VNN1

vanin 1

Synonyms: HDLCQ8 Tiff66
Gene ID:
Human(8876) Summary: This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]
Mouse(22361) vanin 1
Rat(29142) vanin 1
chicken(421702) vanin 1
chicken(421701) vanin 1
dog(442973) vanin 1
cow(526704) vanin 1
Gene Class: Amidase
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004666 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004666 Rosetta Predictions human pricing
NM_001025623 Rosetta Predictions rat pricing
NM_011704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226490 predicted 1260
2 SASI_Hs01_00226491 predicted 855
3 SASI_Hs01_00226492 predicted 963
4 SASI_Hs01_00226493 predicted 1412
5 SASI_Hs01_00226494 predicted 1504
6 SASI_Hs01_00226495 predicted 1187
7 SASI_Hs01_00226496 predicted 1113
8 SASI_Hs01_00226497 predicted 1539
9 SASI_Hs01_00226498 predicted 641
10 SASI_Hs01_00226499 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047728 predicted 1024
2 SASI_Rn01_00047729 predicted 895
3 SASI_Rn02_00203175 predicted 1065
4 SASI_Rn01_00047730 predicted 1382
5 SASI_Rn01_00047731 predicted 1188
6 SASI_Rn01_00047732 predicted 336
7 SASI_Rn01_00047734 predicted 550
8 SASI_Rn01_00047735 predicted 448
9 SASI_Rn01_00047736 predicted 516
10 SASI_Rn02_00203176 predicted 1322
11 SASI_Rn01_00047733 predicted 461
12 SASI_Rn01_00047737 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072800 predicted 266
2 SASI_Mm01_00072801 predicted 596
3 SASI_Mm01_00072802 predicted 1014
4 SASI_Mm01_00072803 predicted 1077
5 SASI_Mm02_00321265 predicted 1322
6 SASI_Mm01_00072804 predicted 324
7 SASI_Mm01_00072805 predicted 804
8 SASI_Mm01_00072806 predicted 971
9 SASI_Mm01_00072807 predicted 442
10 SASI_Mm01_00072808 predicted 933
11 SASI_Mm01_00072809 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004666
VNN1 MISSION shRNA Bacterial Glycerol Stock
vanin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004666.1-1527s1c1
Sequence:CCGGGCACCTATTGTATGCTCATTACTCGAGTAATGAGCATACAATAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004666.1-2046s1c1
Sequence:CCGGCCTCAGAATGTGACTGTATTTCTCGAGAAATACAGTCACATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004666.1-2501s1c1
Sequence:CCGGGCTGATGGATTGATAGTGAAACTCGAGTTTCACTATCAATCCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004666.1-1134s1c1
Sequence:CCGGCCAAATGAAGTGTACGCTCTACTCGAGTAGAGCGTACACTTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004666.1-594s1c1
Sequence:CCGGCCTGAGATTGTGACTTTCAATCTCGAGATTGAAAGTCACAATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004666.2-108s21c1
Sequence:CCGGTATGAGCATGCAGCGATATTGCTCGAGCAATATCGCTGCATGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004666.2-287s21c1
Sequence:CCGGGGACTCTCTCTACCCATATTTCTCGAGAAATATGGGTAGAGAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004666.2-223s21c1
Sequence:CCGGCAGATCAGGGTGCGCATATTACTCGAGTAATATGCGCACCCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004666
VNN1 MISSION shRNA shRNA Plasmid DNA
vanin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004666.1-1527s1c1
Sequence:CCGGGCACCTATTGTATGCTCATTACTCGAGTAATGAGCATACAATAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004666.1-2046s1c1
Sequence:CCGGCCTCAGAATGTGACTGTATTTCTCGAGAAATACAGTCACATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004666.1-2501s1c1
Sequence:CCGGGCTGATGGATTGATAGTGAAACTCGAGTTTCACTATCAATCCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004666.1-1134s1c1
Sequence:CCGGCCAAATGAAGTGTACGCTCTACTCGAGTAGAGCGTACACTTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004666.1-594s1c1
Sequence:CCGGCCTGAGATTGTGACTTTCAATCTCGAGATTGAAAGTCACAATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004666.2-108s21c1
Sequence:CCGGTATGAGCATGCAGCGATATTGCTCGAGCAATATCGCTGCATGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004666.2-287s21c1
Sequence:CCGGGGACTCTCTCTACCCATATTTCTCGAGAAATATGGGTAGAGAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004666.2-223s21c1
Sequence:CCGGCAGATCAGGGTGCGCATATTACTCGAGTAATATGCGCACCCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004666
VNN1 MISSION shRNA Lentiviral Transduction Particles
vanin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004666.1-1527s1c1
Sequence:CCGGGCACCTATTGTATGCTCATTACTCGAGTAATGAGCATACAATAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004666.1-2046s1c1
Sequence:CCGGCCTCAGAATGTGACTGTATTTCTCGAGAAATACAGTCACATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004666.1-2501s1c1
Sequence:CCGGGCTGATGGATTGATAGTGAAACTCGAGTTTCACTATCAATCCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004666.1-1134s1c1
Sequence:CCGGCCAAATGAAGTGTACGCTCTACTCGAGTAGAGCGTACACTTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004666.1-594s1c1
Sequence:CCGGCCTGAGATTGTGACTTTCAATCTCGAGATTGAAAGTCACAATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004666.2-108s21c1
Sequence:CCGGTATGAGCATGCAGCGATATTGCTCGAGCAATATCGCTGCATGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004666.2-287s21c1
Sequence:CCGGGGACTCTCTCTACCCATATTTCTCGAGAAATATGGGTAGAGAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004666.2-223s21c1
Sequence:CCGGCAGATCAGGGTGCGCATATTACTCGAGTAATATGCGCACCCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011704
VALIDATED
VNN1 MISSION shRNA Bacterial Glycerol Stock
vanin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011704.1-1524s1c1
Sequence:CCGGGCTGATTGTGACGCCTATTATCTCGAGATAATAGGCGTCACAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011704.1-813s1c1
Sequence:CCGGCCTAGCAGCTAATCTACATAACTCGAGTTATGTAGATTAGCTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011704.1-1144s1c1
Sequence:CCGGGCAGATGAGGTTTATGCCTTTCTCGAGAAAGGCATAAACCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011704.1-1870s1c1
Sequence:CCGGGCTTAGAATTTCCAATGTGTTCTCGAGAACACATTGGAAATTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011704.1-648s1c1
Sequence:CCGGCGTCTTCACCTGTTTCGATATCTCGAGATATCGAAACAGGTGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011704
VALIDATED
VNN1 MISSION shRNA shRNA Plasmid DNA
vanin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011704.1-1524s1c1
Sequence:CCGGGCTGATTGTGACGCCTATTATCTCGAGATAATAGGCGTCACAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011704.1-813s1c1
Sequence:CCGGCCTAGCAGCTAATCTACATAACTCGAGTTATGTAGATTAGCTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011704.1-1144s1c1
Sequence:CCGGGCAGATGAGGTTTATGCCTTTCTCGAGAAAGGCATAAACCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011704.1-1870s1c1
Sequence:CCGGGCTTAGAATTTCCAATGTGTTCTCGAGAACACATTGGAAATTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011704.1-648s1c1
Sequence:CCGGCGTCTTCACCTGTTTCGATATCTCGAGATATCGAAACAGGTGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011704
VALIDATED
VNN1 MISSION shRNA Lentiviral Transduction Particles
vanin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011704.1-1524s1c1
Sequence:CCGGGCTGATTGTGACGCCTATTATCTCGAGATAATAGGCGTCACAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011704.1-813s1c1
Sequence:CCGGCCTAGCAGCTAATCTACATAACTCGAGTTATGTAGATTAGCTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011704.1-1144s1c1
Sequence:CCGGGCAGATGAGGTTTATGCCTTTCTCGAGAAAGGCATAAACCTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011704.1-1870s1c1
Sequence:CCGGGCTTAGAATTTCCAATGTGTTCTCGAGAACACATTGGAAATTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011704.1-648s1c1
Sequence:CCGGCGTCTTCACCTGTTTCGATATCTCGAGATATCGAAACAGGTGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks