EMAIL THIS PAGE TO A FRIEND

VNN2

vanin 2

Synonyms: FOAP-4 GPI-80
Gene ID:
Human(8875) Summary: This gene product is a member of the Vanin family of proteins that share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. The encoded protein is a GPI-anchored cell surface molecule that plays a role in transendothelial migration of neutrophils. This gene lies in close proximity to, and in same transcriptional orientation as two other vanin genes on chromosome 6q23-q24. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
cow(534929) vanin 2
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_078488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_078488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_078488 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071781 MISSION® esiRNA esiRNA human VNN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004665 Rosetta Predictions human pricing
NM_078488 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194333 predicted 498
2 SASI_Hs01_00194334 predicted 1211
3 SASI_Hs01_00194335 predicted 614
4 SASI_Hs01_00194337 predicted 1068
5 SASI_Hs01_00194339 predicted 959
6 SASI_Hs02_00338086 predicted 476
7 SASI_Hs01_00194340 predicted 1145
8 SASI_Hs02_00338087 predicted 1498
9 SASI_Hs01_00194342 predicted 806
10 SASI_Hs02_00338088 predicted 1341
11 SASI_Hs01_00194336 predicted 1262
12 SASI_Hs01_00194338 predicted 348
13 SASI_Hs01_00194341 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048690 predicted 439
2 SASI_Hs01_00048691 predicted 1151
3 SASI_Hs01_00048692 predicted 547
4 SASI_Hs01_00048694 predicted 1014
5 SASI_Hs01_00048696 predicted 894
6 SASI_Hs02_00362172 predicted 418
7 SASI_Hs01_00048697 predicted 1088
8 SASI_Hs02_00362173 predicted 1443
9 SASI_Hs01_00048699 predicted 746
10 SASI_Hs02_00362174 predicted 1278
11 SASI_Hs01_00048693 predicted 1212
12 SASI_Hs01_00048695 predicted 300
13 SASI_Hs01_00048698 predicted 1438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_078488
VNN2 MISSION shRNA Bacterial Glycerol Stock
vanin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078488.1-542s21c1
Sequence:CCGGGTGACTTTCAACACCGCATTTCTCGAGAAATGCGGTGTTGAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-173s1c1
Sequence:CCGGCGAATCATTGTGACTCCAGAACTCGAGTTCTGGAGTCACAATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-780s1c1
Sequence:CCGGGAAGTGGTATTTATGCACCAACTCGAGTTGGTGCATAAATACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-1448s1c1
Sequence:CCGGGCAATAACTTACCTGCTAATACTCGAGTATTAGCAGGTAAGTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078488.1-1577s1c1
Sequence:CCGGCCCAAGTTTACTAAGAAACTTCTCGAGAAGTTTCTTAGTAAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-1020s1c1
Sequence:CCGGGAAACCTTACAGTCTGTCAAACTCGAGTTTGACAGACTGTAAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-1278s1c1
Sequence:CCGGCTGAAGTGCTACTTACCGAAACTCGAGTTTCGGTAAGTAGCACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_078488
VNN2 MISSION shRNA shRNA Plasmid DNA
vanin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078488.1-542s21c1
Sequence:CCGGGTGACTTTCAACACCGCATTTCTCGAGAAATGCGGTGTTGAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-173s1c1
Sequence:CCGGCGAATCATTGTGACTCCAGAACTCGAGTTCTGGAGTCACAATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-780s1c1
Sequence:CCGGGAAGTGGTATTTATGCACCAACTCGAGTTGGTGCATAAATACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-1448s1c1
Sequence:CCGGGCAATAACTTACCTGCTAATACTCGAGTATTAGCAGGTAAGTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078488.1-1577s1c1
Sequence:CCGGCCCAAGTTTACTAAGAAACTTCTCGAGAAGTTTCTTAGTAAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-1020s1c1
Sequence:CCGGGAAACCTTACAGTCTGTCAAACTCGAGTTTGACAGACTGTAAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-1278s1c1
Sequence:CCGGCTGAAGTGCTACTTACCGAAACTCGAGTTTCGGTAAGTAGCACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_078488
VNN2 MISSION shRNA Lentiviral Transduction Particles
vanin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078488.1-542s21c1
Sequence:CCGGGTGACTTTCAACACCGCATTTCTCGAGAAATGCGGTGTTGAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-173s1c1
Sequence:CCGGCGAATCATTGTGACTCCAGAACTCGAGTTCTGGAGTCACAATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-780s1c1
Sequence:CCGGGAAGTGGTATTTATGCACCAACTCGAGTTGGTGCATAAATACCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-1448s1c1
Sequence:CCGGGCAATAACTTACCTGCTAATACTCGAGTATTAGCAGGTAAGTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078488.1-1577s1c1
Sequence:CCGGCCCAAGTTTACTAAGAAACTTCTCGAGAAGTTTCTTAGTAAACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-1020s1c1
Sequence:CCGGGAAACCTTACAGTCTGTCAAACTCGAGTTTGACAGACTGTAAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078488.1-1278s1c1
Sequence:CCGGCTGAAGTGCTACTTACCGAAACTCGAGTTTCGGTAAGTAGCACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks