EMAIL THIS PAGE TO A FRIEND

VNN3

vanin 3

Synonyms: HSA238982
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_078625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_078625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_078625 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064601 MISSION® esiRNA esiRNA human VNN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024460 Rosetta Predictions human pricing
NM_018399 Rosetta Predictions human pricing
NM_078625 Rosetta Predictions human pricing
NM_001109136 Rosetta Predictions rat pricing
NM_011979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237469 predicted 897
2 SASI_Hs01_00237470 predicted 695
3 SASI_Hs01_00237471 predicted 643
4 SASI_Hs01_00237472 predicted 611
5 SASI_Hs01_00237474 predicted 356
6 SASI_Hs02_00307165 predicted 465
7 SASI_Hs01_00237475 predicted 273
8 SASI_Hs01_00237476 predicted 638
9 SASI_Hs01_00237477 predicted 919
10 SASI_Hs01_00237478 predicted 516
11 SASI_Hs01_00237473 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233114 predicted 1274
2 SASI_Hs01_00233115 predicted 1021
3 SASI_Hs01_00233117 predicted 1247
4 SASI_Hs01_00233118 predicted 915
5 SASI_Hs01_00233119 predicted 1268
6 SASI_Hs02_00351890 predicted 1244
7 SASI_Hs02_00351891 predicted 1250
8 SASI_Hs02_00351892 predicted 843
9 SASI_Hs01_00233121 predicted 884
10 SASI_Hs01_00233122 predicted 650
11 SASI_Hs01_00233116 predicted 855
12 SASI_Hs01_00233120 predicted 1169
13 SASI_Hs01_00233123 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129176 predicted 848
2 SASI_Hs01_00129177 predicted 496
3 SASI_Hs01_00129178 predicted 762
4 SASI_Hs01_00129179 predicted 262
5 SASI_Hs02_00362175 predicted 461
6 SASI_Hs01_00129180 predicted 612
7 SASI_Hs01_00129181 predicted 349
8 SASI_Hs01_00129182 predicted 668
9 SASI_Hs01_00129183 predicted 484
10 SASI_Hs01_00129184 predicted 523
11 SASI_Hs01_00129185 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245480 predicted 421
2 SASI_Rn02_00245481 predicted 1061
3 SASI_Rn02_00245482 predicted 638
4 SASI_Rn02_00245483 predicted 1314
5 SASI_Rn02_00245484 predicted 1176
6 SASI_Rn02_00245485 predicted 1298
7 SASI_Rn02_00245486 predicted 399
8 SASI_Rn02_00245487 predicted 1314
9 SASI_Rn02_00245488 predicted 609
10 SASI_Rn02_00245489 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041504 predicted 1304
2 SASI_Mm01_00041505 predicted 1292
3 SASI_Mm01_00041506 predicted 657
4 SASI_Mm01_00041507 predicted 626
5 SASI_Mm01_00041508 predicted 630
6 SASI_Mm02_00321894 predicted 964
7 SASI_Mm01_00041509 predicted 541
8 SASI_Mm01_00041511 predicted 1172
9 SASI_Mm01_00041512 predicted 356
10 SASI_Mm01_00041513 predicted 392
11 SASI_Mm01_00041510 predicted 1532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_078625
VNN3 MISSION shRNA Bacterial Glycerol Stock
vanin 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163349    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078625.1-613s1c1
Sequence:CCGGGCAACACACCAGTGCAACAAACTCGAGTTTGTTGCACTGGTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-165s1c1
Sequence:CCGGCGGTGATATTACCAAACAGAACTCGAGTTCTGTTTGGTAATATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078625.1-552s1c1
Sequence:CCGGGCTGAGTGATAAATCACTAAACTCGAGTTTAGTGATTTATCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-183s1c1
Sequence:CCGGGAACAGAAACACCTGTTTCAACTCGAGTTGAAACAGGTGTTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-483s1c1
Sequence:CCGGGCCAATGGAAATTGTATAGGACTCGAGTCCTATACAATTTCCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160543    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078625.1-596s1c1
Sequence:CCGGCTATTGAATTAGATTCGGCAACTCGAGTTGCCGAATCTAATTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-300s1c1
Sequence:CCGGCAGAAGATGGAATCTATGGTTCTCGAGAACCATAGATTCCATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-160s1c1
Sequence:CCGGGCATGCGGTGATATTACCAAACTCGAGTTTGGTAATATCACCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-443s1c1
Sequence:CCGGGAGCTTTGCTATCACTGTCATCTCGAGATGACAGTGATAGCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_078625
VNN3 MISSION shRNA shRNA Plasmid DNA
vanin 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163349    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078625.1-613s1c1
Sequence:CCGGGCAACACACCAGTGCAACAAACTCGAGTTTGTTGCACTGGTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-165s1c1
Sequence:CCGGCGGTGATATTACCAAACAGAACTCGAGTTCTGTTTGGTAATATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078625.1-552s1c1
Sequence:CCGGGCTGAGTGATAAATCACTAAACTCGAGTTTAGTGATTTATCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-183s1c1
Sequence:CCGGGAACAGAAACACCTGTTTCAACTCGAGTTGAAACAGGTGTTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-483s1c1
Sequence:CCGGGCCAATGGAAATTGTATAGGACTCGAGTCCTATACAATTTCCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160543    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078625.1-596s1c1
Sequence:CCGGCTATTGAATTAGATTCGGCAACTCGAGTTGCCGAATCTAATTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-300s1c1
Sequence:CCGGCAGAAGATGGAATCTATGGTTCTCGAGAACCATAGATTCCATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-160s1c1
Sequence:CCGGGCATGCGGTGATATTACCAAACTCGAGTTTGGTAATATCACCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-443s1c1
Sequence:CCGGGAGCTTTGCTATCACTGTCATCTCGAGATGACAGTGATAGCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_078625
VNN3 MISSION shRNA Lentiviral Transduction Particles
vanin 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163349    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078625.1-613s1c1
Sequence:CCGGGCAACACACCAGTGCAACAAACTCGAGTTTGTTGCACTGGTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-165s1c1
Sequence:CCGGCGGTGATATTACCAAACAGAACTCGAGTTCTGTTTGGTAATATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078625.1-552s1c1
Sequence:CCGGGCTGAGTGATAAATCACTAAACTCGAGTTTAGTGATTTATCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-183s1c1
Sequence:CCGGGAACAGAAACACCTGTTTCAACTCGAGTTGAAACAGGTGTTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-483s1c1
Sequence:CCGGGCCAATGGAAATTGTATAGGACTCGAGTCCTATACAATTTCCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160543    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_078625.1-596s1c1
Sequence:CCGGCTATTGAATTAGATTCGGCAACTCGAGTTGCCGAATCTAATTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-300s1c1
Sequence:CCGGCAGAAGATGGAATCTATGGTTCTCGAGAACCATAGATTCCATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-160s1c1
Sequence:CCGGGCATGCGGTGATATTACCAAACTCGAGTTTGGTAATATCACCGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078625.1-443s1c1
Sequence:CCGGGAGCTTTGCTATCACTGTCATCTCGAGATGACAGTGATAGCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011979
VNN3 MISSION shRNA Bacterial Glycerol Stock
vanin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011979.1-1667s1c1
Sequence:CCGGGCACAGGATTAGCCTGGCAGACTCGAGTCTGCCAGGCTAATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-1466s1c1
Sequence:CCGGGCCCTGGAAAGATATTATGAACTCGAGTTCATAATATCTTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-637s1c1
Sequence:CCGGCCGCTACCATAAGTACAATCTCTCGAGAGATTGTACTTATGGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-583s1c1
Sequence:CCGGCCGTTACCAATATAATACCAACTCGAGTTGGTATTATATTGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-638s1c1
Sequence:CCGGCGCTACCATAAGTACAATCTTCTCGAGAAGATTGTACTTATGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011979
VNN3 MISSION shRNA shRNA Plasmid DNA
vanin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011979.1-1667s1c1
Sequence:CCGGGCACAGGATTAGCCTGGCAGACTCGAGTCTGCCAGGCTAATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-1466s1c1
Sequence:CCGGGCCCTGGAAAGATATTATGAACTCGAGTTCATAATATCTTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-637s1c1
Sequence:CCGGCCGCTACCATAAGTACAATCTCTCGAGAGATTGTACTTATGGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-583s1c1
Sequence:CCGGCCGTTACCAATATAATACCAACTCGAGTTGGTATTATATTGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-638s1c1
Sequence:CCGGCGCTACCATAAGTACAATCTTCTCGAGAAGATTGTACTTATGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011979
VNN3 MISSION shRNA Lentiviral Transduction Particles
vanin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011979.1-1667s1c1
Sequence:CCGGGCACAGGATTAGCCTGGCAGACTCGAGTCTGCCAGGCTAATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-1466s1c1
Sequence:CCGGGCCCTGGAAAGATATTATGAACTCGAGTTCATAATATCTTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-637s1c1
Sequence:CCGGCCGCTACCATAAGTACAATCTCTCGAGAGATTGTACTTATGGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-583s1c1
Sequence:CCGGCCGTTACCAATATAATACCAACTCGAGTTGGTATTATATTGGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011979.1-638s1c1
Sequence:CCGGCGCTACCATAAGTACAATCTTCTCGAGAAGATTGTACTTATGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks