EMAIL THIS PAGE TO A FRIEND

VOPP1

vesicular, overexpressed in cancer, prosurvival protein 1

Synonyms: ECOP GASP
Gene ID:
Mouse(232023) vesicular, overexpressed in cancer, prosurvival protein 1
Rat(362374) vesicular, overexpressed in cancer, prosurvival protein 1
domestic guinea pig(100733790) vesicular, overexpressed in cancer, prosurvival protein 1
naked mole-rat(101722833) vesicular, overexpressed in cancer, prosurvival protein 1
cow(767861) vesicular, overexpressed in cancer, prosurvival protein 1
sheep(101101926) vesicular, overexpressed in cancer, prosurvival protein 1
chicken(776358) vesicular, overexpressed in cancer, prosurvival protein 1
dog(608562) vesicular, overexpressed in cancer, prosurvival protein 1
domestic cat(101087215) vesicular, overexpressed in cancer, prosurvival protein 1
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030796 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030796 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030796 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051661 MISSION® esiRNA esiRNA targeting mouse AW146242 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030796 Rosetta Predictions human pricing
NM_001108630 Rosetta Predictions rat pricing
NM_146168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030772 predicted 844
2 SASI_Hs01_00030774 predicted 1067
3 SASI_Hs01_00030775 predicted 872
4 SASI_Hs01_00030776 predicted 854
5 SASI_Hs01_00030778 predicted 1066
6 SASI_Hs02_00358354 predicted 1175
7 SASI_Hs01_00030779 predicted 374
8 SASI_Hs01_00030780 predicted 877
9 SASI_Hs01_00030781 predicted 826
10 SASI_Hs02_00358355 predicted 826
11 SASI_Hs01_00030773 predicted 694
12 SASI_Hs01_00030777 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240519 predicted 239
2 SASI_Rn02_00240520 predicted 987
3 SASI_Rn02_00240521 predicted 975
4 SASI_Rn02_00240522 predicted 759
5 SASI_Rn02_00240523 predicted 318
6 SASI_Rn02_00240524 predicted 429
7 SASI_Rn02_00240525 predicted 1166
8 SASI_Rn02_00240526 predicted 949
9 SASI_Rn02_00240527 predicted 523
10 SASI_Rn02_00240528 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341863 predicted 423
2 SASI_Mm01_00193930 predicted 976
3 SASI_Mm01_00193931 predicted 229
4 SASI_Mm01_00193933 predicted 1150
5 SASI_Mm01_00193934 predicted 667
6 SASI_Mm01_00193935 predicted 1000
7 SASI_Mm02_00341864 predicted 309
8 SASI_Mm01_00193936 predicted 479
9 SASI_Mm01_00193937 predicted 472
10 SASI_Mm01_00193938 predicted 659
11 SASI_Mm01_00193932 predicted 250
12 SASI_Mm01_00193939 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146168
VALIDATED
VOPP1 MISSION shRNA Bacterial Glycerol Stock
vesicular, overexpressed in cancer, prosurvival protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-263s1c1
Sequence:CCGGCGTTCCTATGAAGACTGCTGTCTCGAGACAGCAGTCTTCATAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-1919s1c1
Sequence:CCGGGCTGACATTGTAAATGAGAAACTCGAGTTTCTCATTTACAATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-526s1c1
Sequence:CCGGGAATCCTGTTGGCAATACCATCTCGAGATGGTATTGCCAACAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-1092s1c1
Sequence:CCGGGCTGTGTTGTTGATGCTCTTTCTCGAGAAAGAGCATCAACAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146168
VALIDATED
VOPP1 MISSION shRNA shRNA Plasmid DNA
vesicular, overexpressed in cancer, prosurvival protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-263s1c1
Sequence:CCGGCGTTCCTATGAAGACTGCTGTCTCGAGACAGCAGTCTTCATAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-1919s1c1
Sequence:CCGGGCTGACATTGTAAATGAGAAACTCGAGTTTCTCATTTACAATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-526s1c1
Sequence:CCGGGAATCCTGTTGGCAATACCATCTCGAGATGGTATTGCCAACAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-1092s1c1
Sequence:CCGGGCTGTGTTGTTGATGCTCTTTCTCGAGAAAGAGCATCAACAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146168
VALIDATED
VOPP1 MISSION shRNA Lentiviral Transduction Particles
vesicular, overexpressed in cancer, prosurvival protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-263s1c1
Sequence:CCGGCGTTCCTATGAAGACTGCTGTCTCGAGACAGCAGTCTTCATAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-1919s1c1
Sequence:CCGGGCTGACATTGTAAATGAGAAACTCGAGTTTCTCATTTACAATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-526s1c1
Sequence:CCGGGAATCCTGTTGGCAATACCATCTCGAGATGGTATTGCCAACAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190849    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146168.1-1092s1c1
Sequence:CCGGGCTGTGTTGTTGATGCTCTTTCTCGAGAAAGAGCATCAACAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030796
VALIDATED
VOPP1 MISSION shRNA Bacterial Glycerol Stock
vesicular, overexpressed in cancer, prosurvival protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030796.2-1370s1c1
Sequence:CCGGCCAAACTGAGACATTGCATTTCTCGAGAAATGCAATGTCTCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030796.2-2317s1c1
Sequence:CCGGCAAAGCACAATGTTCACTGTTCTCGAGAACAGTGAACATTGTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030796.2-203s1c1
Sequence:CCGGCATTGCTGGTATTTCGAAGGACTCGAGTCCTTCGAAATACCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030796.2-217s1c1
Sequence:CCGGCGAAGGACTCTATCCAACCTACTCGAGTAGGTTGGATAGAGTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030796.2-414s1c1
Sequence:CCGGCCTTCAATGTGTCCTACACCACTCGAGTGGTGTAGGACACATTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030796.2-308s1c1
Sequence:CCGGCTGTGGTACTTCTGGTTCCTTCTCGAGAAGGAACCAGAAGTACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-353s21c1
Sequence:CCGGTACAGAGGCTGTGGTACTTCTCTCGAGAGAAGTACCACAGCCTCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-454s21c1
Sequence:CCGGATCGAGGAGCCAGCCTTCAATCTCGAGATTGAAGGCTGGCTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030796.3-673s21c1
Sequence:CCGGCCGTACGAACAGGTAGTGAAGCTCGAGCTTCACTACCTGTTCGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-849s21c1
Sequence:CCGGGGCTTTCCATGGAGTACAATACTCGAGTATTGTACTCCATGGAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-276s21c1
Sequence:CCGGACTCTATCCAACCTATTATATCTCGAGATATAATAGGTTGGATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030796
VALIDATED
VOPP1 MISSION shRNA shRNA Plasmid DNA
vesicular, overexpressed in cancer, prosurvival protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030796.2-1370s1c1
Sequence:CCGGCCAAACTGAGACATTGCATTTCTCGAGAAATGCAATGTCTCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030796.2-2317s1c1
Sequence:CCGGCAAAGCACAATGTTCACTGTTCTCGAGAACAGTGAACATTGTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030796.2-203s1c1
Sequence:CCGGCATTGCTGGTATTTCGAAGGACTCGAGTCCTTCGAAATACCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030796.2-217s1c1
Sequence:CCGGCGAAGGACTCTATCCAACCTACTCGAGTAGGTTGGATAGAGTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030796.2-414s1c1
Sequence:CCGGCCTTCAATGTGTCCTACACCACTCGAGTGGTGTAGGACACATTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030796.2-308s1c1
Sequence:CCGGCTGTGGTACTTCTGGTTCCTTCTCGAGAAGGAACCAGAAGTACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-353s21c1
Sequence:CCGGTACAGAGGCTGTGGTACTTCTCTCGAGAGAAGTACCACAGCCTCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-454s21c1
Sequence:CCGGATCGAGGAGCCAGCCTTCAATCTCGAGATTGAAGGCTGGCTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030796.3-673s21c1
Sequence:CCGGCCGTACGAACAGGTAGTGAAGCTCGAGCTTCACTACCTGTTCGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-849s21c1
Sequence:CCGGGGCTTTCCATGGAGTACAATACTCGAGTATTGTACTCCATGGAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-276s21c1
Sequence:CCGGACTCTATCCAACCTATTATATCTCGAGATATAATAGGTTGGATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030796
VALIDATED
VOPP1 MISSION shRNA Lentiviral Transduction Particles
vesicular, overexpressed in cancer, prosurvival protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030796.2-1370s1c1
Sequence:CCGGCCAAACTGAGACATTGCATTTCTCGAGAAATGCAATGTCTCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144471    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030796.2-2317s1c1
Sequence:CCGGCAAAGCACAATGTTCACTGTTCTCGAGAACAGTGAACATTGTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030796.2-203s1c1
Sequence:CCGGCATTGCTGGTATTTCGAAGGACTCGAGTCCTTCGAAATACCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030796.2-217s1c1
Sequence:CCGGCGAAGGACTCTATCCAACCTACTCGAGTAGGTTGGATAGAGTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030796.2-414s1c1
Sequence:CCGGCCTTCAATGTGTCCTACACCACTCGAGTGGTGTAGGACACATTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030796.2-308s1c1
Sequence:CCGGCTGTGGTACTTCTGGTTCCTTCTCGAGAAGGAACCAGAAGTACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-353s21c1
Sequence:CCGGTACAGAGGCTGTGGTACTTCTCTCGAGAGAAGTACCACAGCCTCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-454s21c1
Sequence:CCGGATCGAGGAGCCAGCCTTCAATCTCGAGATTGAAGGCTGGCTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030796.3-673s21c1
Sequence:CCGGCCGTACGAACAGGTAGTGAAGCTCGAGCTTCACTACCTGTTCGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-849s21c1
Sequence:CCGGGGCTTTCCATGGAGTACAATACTCGAGTATTGTACTCCATGGAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030796.3-276s21c1
Sequence:CCGGACTCTATCCAACCTATTATATCTCGAGATATAATAGGTTGGATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks