EMAIL THIS PAGE TO A FRIEND

VPRBP

Vpr (HIV-1) binding protein

Synonyms: DCAF1
UniProtKB ID: Q9Y4B6, Q2YD74, Q8TBD9, Q9HCA1, Q9UG37
Gene ID:
Mouse(321006) Vpr (HIV-1) binding protein
Rat(315987) Vpr (HIV-1) binding protein
Zebrafish(100333081) Vpr (HIV-1) binding protein
dog(476609) Vpr (HIV-1) binding protein
chicken(415921) Vpr (HIV-1) binding protein
Horse(100061218) Vpr (HIV-1) binding protein
domestic cat(101097051) Vpr (HIV-1) binding protein
cow(541079) Vpr (HIV-1) binding protein
sheep(101117795) Vpr (HIV-1) binding protein
cow(785711) Vpr (HIV-1) binding protein
naked mole-rat(101720808) Vpr (HIV-1) binding protein
Domestic Rabbit(100343053) Vpr (HIV-1) binding protein
domestic guinea pig(100734659) Vpr (HIV-1) binding protein
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001015507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001015507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001015507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_376232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376232 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014703 Rosetta Predictions human pricing
XM_001071998 Rosetta Predictions rat pricing
XM_236612 Rosetta Predictions rat pricing
NM_001015507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230221 predicted 3305
2 SASI_Hs01_00230222 predicted 1362
3 SASI_Hs01_00230224 predicted 1837
4 SASI_Hs01_00230225 predicted 3384
5 SASI_Hs02_00346115 predicted 2667
6 SASI_Hs01_00230226 predicted 3326
7 SASI_Hs01_00230227 predicted 3787
8 SASI_Hs01_00230228 predicted 676
9 SASI_Hs01_00230229 predicted 3997
10 SASI_Hs02_00346116 predicted 1905
11 SASI_Hs01_00230223 predicted 1485
12 SASI_Hs01_00230230 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337273 predicted 3326
2 SASI_Rn02_00337274 predicted 1143
3 SASI_Rn02_00337275 predicted 3942
4 SASI_Rn02_00337276 predicted 2188
5 SASI_Rn02_00337277 predicted 801
6 SASI_Rn02_00337278 predicted 1768
7 SASI_Rn02_00337279 predicted 1030
8 SASI_Rn02_00337280 predicted 1892
9 SASI_Rn02_00337281 predicted 303
10 SASI_Rn02_00337282 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390219 predicted 1148
2 SASI_Rn02_00390220 predicted 2181
3 SASI_Rn02_00390221 predicted 805
4 SASI_Rn02_00390222 predicted 1770
5 SASI_Rn02_00390223 predicted 1026
6 SASI_Rn02_00390224 predicted 1900
7 SASI_Rn02_00390225 predicted 302
8 SASI_Rn02_00390226 predicted 2283
9 SASI_Rn02_00390227 predicted 1075
10 SASI_Rn02_00390228 predicted 3116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287457 predicted 596
2 SASI_Mm01_00103503 predicted 2196
3 SASI_Mm01_00103504 predicted 3738
4 SASI_Mm02_00287458 predicted 1787
5 SASI_Mm01_00103505 predicted 818
6 SASI_Mm01_00103507 predicted 1088
7 SASI_Mm01_00103508 predicted 3273
8 SASI_Mm01_00103509 predicted 1958
9 SASI_Mm01_00103510 predicted 2414
10 SASI_Mm01_00103511 predicted 3507
11 SASI_Mm01_00103502 predicted 1067
12 SASI_Mm01_00103506 predicted 327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001015507
VALIDATED
VPRBP MISSION shRNA Bacterial Glycerol Stock
Vpr (HIV-1) binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001015507.1-1943s21c1
Sequence:CCGGTGCAATTGGAAGACCTATTATCTCGAGATAATAGGTCTTCCAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001015507.1-1854s21c1
Sequence:CCGGATGGCCCAGCTCAGCTATATTCTCGAGAATATAGCTGAGCTGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015507.1-3281s21c1
Sequence:CCGGCTAAACCGCAGGGCATCATTTCTCGAGAAATGATGCCCTGCGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015507.1-4128s21c1
Sequence:CCGGCATTCAACGCAACTGATTATACTCGAGTATAATCAGTTGCGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001015507.1-4505s21c1
Sequence:CCGGGCATTCAGAGGACTATGATTTCTCGAGAAATCATAGTCCTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001015507
VALIDATED
VPRBP MISSION shRNA shRNA Plasmid DNA
Vpr (HIV-1) binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001015507.1-1943s21c1
Sequence:CCGGTGCAATTGGAAGACCTATTATCTCGAGATAATAGGTCTTCCAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001015507.1-1854s21c1
Sequence:CCGGATGGCCCAGCTCAGCTATATTCTCGAGAATATAGCTGAGCTGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015507.1-3281s21c1
Sequence:CCGGCTAAACCGCAGGGCATCATTTCTCGAGAAATGATGCCCTGCGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015507.1-4128s21c1
Sequence:CCGGCATTCAACGCAACTGATTATACTCGAGTATAATCAGTTGCGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001015507.1-4505s21c1
Sequence:CCGGGCATTCAGAGGACTATGATTTCTCGAGAAATCATAGTCCTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001015507
VALIDATED
VPRBP MISSION shRNA Lentiviral Transduction Particles
Vpr (HIV-1) binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001015507.1-1943s21c1
Sequence:CCGGTGCAATTGGAAGACCTATTATCTCGAGATAATAGGTCTTCCAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001015507.1-1854s21c1
Sequence:CCGGATGGCCCAGCTCAGCTATATTCTCGAGAATATAGCTGAGCTGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015507.1-3281s21c1
Sequence:CCGGCTAAACCGCAGGGCATCATTTCTCGAGAAATGATGCCCTGCGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015507.1-4128s21c1
Sequence:CCGGCATTCAACGCAACTGATTATACTCGAGTATAATCAGTTGCGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001015507.1-4505s21c1
Sequence:CCGGGCATTCAGAGGACTATGATTTCTCGAGAAATCATAGTCCTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376232
VALIDATED
VPRBP MISSION shRNA Bacterial Glycerol Stock
Vpr (HIV-1) binding protein
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376232.1-1988s1c1
Sequence:CCGGGCGCCAATAAACTTTACGTCACTCGAGTGACGTAAAGTTTATTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-421s1c1
Sequence:CCGGGCTGAGAATACTCTTCAAGAACTCGAGTTCTTGAAGAGTATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-3412s1c1
Sequence:CCGGCGAGAAACTGAGTCAAATGAACTCGAGTTCATTTGACTCAGTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-1494s1c1
Sequence:CCGGCCTCCCATTCTTCTGCCTTTACTCGAGTAAAGGCAGAAGAATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-1562s1c1
Sequence:CCGGCGTATCGCTAATGGCATTGCACTCGAGTGCAATGCCATTAGCGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376232.1-1310s1c1
Sequence:CCGGCCACTTCTCATTGGCACTGATCTCGAGATCAGTGCCAATGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376232
VALIDATED
VPRBP MISSION shRNA shRNA Plasmid DNA
Vpr (HIV-1) binding protein
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376232.1-1988s1c1
Sequence:CCGGGCGCCAATAAACTTTACGTCACTCGAGTGACGTAAAGTTTATTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-421s1c1
Sequence:CCGGGCTGAGAATACTCTTCAAGAACTCGAGTTCTTGAAGAGTATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-3412s1c1
Sequence:CCGGCGAGAAACTGAGTCAAATGAACTCGAGTTCATTTGACTCAGTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-1494s1c1
Sequence:CCGGCCTCCCATTCTTCTGCCTTTACTCGAGTAAAGGCAGAAGAATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-1562s1c1
Sequence:CCGGCGTATCGCTAATGGCATTGCACTCGAGTGCAATGCCATTAGCGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376232.1-1310s1c1
Sequence:CCGGCCACTTCTCATTGGCACTGATCTCGAGATCAGTGCCAATGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376232
VALIDATED
VPRBP MISSION shRNA Lentiviral Transduction Particles
Vpr (HIV-1) binding protein
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376232.1-1988s1c1
Sequence:CCGGGCGCCAATAAACTTTACGTCACTCGAGTGACGTAAAGTTTATTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-421s1c1
Sequence:CCGGGCTGAGAATACTCTTCAAGAACTCGAGTTCTTGAAGAGTATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-3412s1c1
Sequence:CCGGCGAGAAACTGAGTCAAATGAACTCGAGTTCATTTGACTCAGTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-1494s1c1
Sequence:CCGGCCTCCCATTCTTCTGCCTTTACTCGAGTAAAGGCAGAAGAATGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_376232.1-1562s1c1
Sequence:CCGGCGTATCGCTAATGGCATTGCACTCGAGTGCAATGCCATTAGCGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376232.1-1310s1c1
Sequence:CCGGCCACTTCTCATTGGCACTGATCTCGAGATCAGTGCCAATGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks