EMAIL THIS PAGE TO A FRIEND

VPREB1

pre-B lymphocyte 1

Synonyms: IGI IGVPB VPREB
UniProtKB ID: P12018, B5MCG2
Gene ID:
Human(7441) Summary: The protein encoded by this gene belongs to the immunoglobulin superfamily and is expressed selectively at the early stages of B cell development, namely, in proB and early preB cells. This gene encodes the iota polypeptide chain that is associated with the Ig-mu chain to form a molecular complex which is expressed on the surface of pre-B cells. The complex is thought to regulate Ig gene rearrangements in the early steps of B-cell differentiation. [provided by RefSeq, Oct 2008]
Mouse(22362) pre-B lymphocyte gene 1
Rat(303782) pre-B lymphocyte 1
Domestic Rabbit(100328957) pre-B lymphocyte 1
naked mole-rat(101707791) pre-B lymphocyte 1
cow(407114) pre-B lymphocyte 1
dog(486411) immunoglobulin omega chain-like
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007128 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016982 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016982 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016982 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007128 Rosetta Predictions human pricing
NM_001108845 Rosetta Predictions rat pricing
XM_001081953 Rosetta Predictions rat pricing
XM_221258 Rosetta Predictions rat pricing
NM_016982 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028928 predicted 592
2 SASI_Hs01_00028929 predicted 214
3 SASI_Hs01_00028930 predicted 605
4 SASI_Hs01_00028931 predicted 226
5 SASI_Hs01_00028932 predicted 447
6 SASI_Hs01_00028933 predicted 351
7 SASI_Hs01_00028934 predicted 30
8 SASI_Hs02_00343015 predicted 183
9 SASI_Hs01_00028935 predicted 34
10 SASI_Hs01_00028936 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242645 predicted 260
2 SASI_Rn02_00242646 predicted 250
3 SASI_Rn02_00242647 predicted 328
4 SASI_Rn02_00242648 predicted 377
5 SASI_Rn02_00242649 predicted 374
6 SASI_Rn02_00242650 predicted 311
7 SASI_Rn02_00242651 predicted 308
8 SASI_Rn02_00242652 predicted 320
9 SASI_Rn02_00242653 predicted 268
10 SASI_Rn02_00242654 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374191 predicted 213
2 SASI_Rn02_00374192 predicted 273
3 SASI_Rn02_00374193 predicted 261
4 SASI_Rn02_00374194 predicted 243
5 SASI_Rn02_00374195 predicted 259
6 SASI_Rn02_00374196 predicted 234
7 SASI_Rn02_00374197 predicted 209
8 SASI_Rn02_00374198 predicted 252
9 SASI_Rn02_00374199 predicted 267
10 SASI_Rn02_00374200 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379974 predicted 199
2 SASI_Rn02_00379975 predicted 496
3 SASI_Rn02_00379976 predicted 460
4 SASI_Rn02_00379977 predicted 478
5 SASI_Rn02_00379978 predicted 327
6 SASI_Rn02_00379979 predicted 358
7 SASI_Rn02_00379980 predicted 325
8 SASI_Rn02_00379981 predicted 483
9 SASI_Rn02_00379982 predicted 392
10 SASI_Rn02_00379983 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185850 predicted 654
2 SASI_Mm01_00185851 predicted 685
3 SASI_Mm02_00323838 predicted 557
4 SASI_Mm01_00185852 predicted 574
5 SASI_Mm01_00185854 predicted 724
6 SASI_Mm01_00185853 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007128
VPREB1 MISSION shRNA Bacterial Glycerol Stock
pre-B lymphocyte 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-161s1c1
Sequence:CCGGCGACCATGACATCGGTGTGTACTCGAGTACACACCGATGTCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-351s1c1
Sequence:CCGGGACGAGGCTATGTATTACTGTCTCGAGACAGTAATACATAGCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-228s1c1
Sequence:CCGGCTGCTGAGATATTTCTCACAACTCGAGTTGTGAGAAATATCTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-231s1c1
Sequence:CCGGCTGAGATATTTCTCACAATCACTCGAGTGATTGTGAGAAATATCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-115s1c1
Sequence:CCGGCCTCGGCCCTTGGAACCACAACTCGAGTTGTGGTTCCAAGGGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007128.2-61s21c1
Sequence:CCGGTCTACTGCACAGGTTGTGGTCCTCGAGGACCACAACCTGTGCAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007128.2-450s21c1
Sequence:CCGGACACGTGTCCCTTGAACTGAACTCGAGTTCAGTTCAAGGGACACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007128.2-243s21c1
Sequence:CCGGTCACAATCAGACAAGAGCCAGCTCGAGCTGGCTCTTGTCTGATTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007128
VPREB1 MISSION shRNA shRNA Plasmid DNA
pre-B lymphocyte 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-161s1c1
Sequence:CCGGCGACCATGACATCGGTGTGTACTCGAGTACACACCGATGTCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-351s1c1
Sequence:CCGGGACGAGGCTATGTATTACTGTCTCGAGACAGTAATACATAGCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-228s1c1
Sequence:CCGGCTGCTGAGATATTTCTCACAACTCGAGTTGTGAGAAATATCTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-231s1c1
Sequence:CCGGCTGAGATATTTCTCACAATCACTCGAGTGATTGTGAGAAATATCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-115s1c1
Sequence:CCGGCCTCGGCCCTTGGAACCACAACTCGAGTTGTGGTTCCAAGGGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007128.2-61s21c1
Sequence:CCGGTCTACTGCACAGGTTGTGGTCCTCGAGGACCACAACCTGTGCAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007128.2-450s21c1
Sequence:CCGGACACGTGTCCCTTGAACTGAACTCGAGTTCAGTTCAAGGGACACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007128.2-243s21c1
Sequence:CCGGTCACAATCAGACAAGAGCCAGCTCGAGCTGGCTCTTGTCTGATTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007128
VPREB1 MISSION shRNA Lentiviral Transduction Particles
pre-B lymphocyte 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-161s1c1
Sequence:CCGGCGACCATGACATCGGTGTGTACTCGAGTACACACCGATGTCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-351s1c1
Sequence:CCGGGACGAGGCTATGTATTACTGTCTCGAGACAGTAATACATAGCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-228s1c1
Sequence:CCGGCTGCTGAGATATTTCTCACAACTCGAGTTGTGAGAAATATCTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-231s1c1
Sequence:CCGGCTGAGATATTTCTCACAATCACTCGAGTGATTGTGAGAAATATCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007128.2-115s1c1
Sequence:CCGGCCTCGGCCCTTGGAACCACAACTCGAGTTGTGGTTCCAAGGGCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007128.2-61s21c1
Sequence:CCGGTCTACTGCACAGGTTGTGGTCCTCGAGGACCACAACCTGTGCAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007128.2-450s21c1
Sequence:CCGGACACGTGTCCCTTGAACTGAACTCGAGTTCAGTTCAAGGGACACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007128.2-243s21c1
Sequence:CCGGTCACAATCAGACAAGAGCCAGCTCGAGCTGGCTCTTGTCTGATTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016982
VPREB1 MISSION shRNA Bacterial Glycerol Stock
pre-B lymphocyte 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-218s1c1
Sequence:CCGGCCATTAGCATCTTCTTCCCTTCTCGAGAAGGGAAGAAGATGCTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-283s1c1
Sequence:CCGGCATTGGCATTTACAGCATTTACTCGAGTAAATGCTGTAAATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-406s1c1
Sequence:CCGGGTCCAAAGATACGACCAGGAACTCGAGTTCCTGGTCGTATCTTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-546s1c1
Sequence:CCGGCGTATACAGATTTGGGATCTTCTCGAGAAGATCCCAAATCTGTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-274s1c1
Sequence:CCGGCGACCATAACATTGGCATTTACTCGAGTAAATGCCAATGTTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016982
VPREB1 MISSION shRNA shRNA Plasmid DNA
pre-B lymphocyte 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-218s1c1
Sequence:CCGGCCATTAGCATCTTCTTCCCTTCTCGAGAAGGGAAGAAGATGCTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-283s1c1
Sequence:CCGGCATTGGCATTTACAGCATTTACTCGAGTAAATGCTGTAAATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-406s1c1
Sequence:CCGGGTCCAAAGATACGACCAGGAACTCGAGTTCCTGGTCGTATCTTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-546s1c1
Sequence:CCGGCGTATACAGATTTGGGATCTTCTCGAGAAGATCCCAAATCTGTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-274s1c1
Sequence:CCGGCGACCATAACATTGGCATTTACTCGAGTAAATGCCAATGTTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016982
VPREB1 MISSION shRNA Lentiviral Transduction Particles
pre-B lymphocyte 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-218s1c1
Sequence:CCGGCCATTAGCATCTTCTTCCCTTCTCGAGAAGGGAAGAAGATGCTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-283s1c1
Sequence:CCGGCATTGGCATTTACAGCATTTACTCGAGTAAATGCTGTAAATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-406s1c1
Sequence:CCGGGTCCAAAGATACGACCAGGAACTCGAGTTCCTGGTCGTATCTTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-546s1c1
Sequence:CCGGCGTATACAGATTTGGGATCTTCTCGAGAAGATCCCAAATCTGTATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016982.1-274s1c1
Sequence:CCGGCGACCATAACATTGGCATTTACTCGAGTAAATGCCAATGTTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks