EMAIL THIS PAGE TO A FRIEND

VPREB3

pre-B lymphocyte 3

Synonyms: 8HS20 N27C7-2
UniProtKB ID: Q9UKI3, B2R587
Gene ID:
Human(29802) Summary: The protein encoded by this gene is the human homolog of the mouse VpreB3 (8HS20) protein, and is specifically expressed in cell lines representative of all stages of B-cell differentiation. It is also related to VPREB1 and other members of the immunoglobulin supergene family. This protein associates with membrane mu heavy chains early in the course of pre-B cell receptor biosynthesis. The precise function of the protein is not known, but it may contribute to mu chain transport in pre-B cells. [provided by RefSeq, Sep 2008]
Mouse(22364) pre-B lymphocyte gene 3
Rat(365550) pre-B lymphocyte 3
domestic guinea pig(100715931) pre-B lymphocyte 3
naked mole-rat(101701225) pre-B lymphocyte 3
cow(615795) pre-B lymphocyte 3
sheep(101118561) pre-B lymphocyte 3
chicken(416932) pre-B lymphocyte 3
domestic cat(101092056) pre-B lymphocyte 3
dog(100683248) pre-B lymphocyte 3
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013378 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013378 Rosetta Predictions human pricing
NM_001108930 Rosetta Predictions rat pricing
NM_009514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101335 predicted 235
2 SASI_Hs01_00101336 predicted 285
3 SASI_Hs01_00101337 predicted 354
4 SASI_Hs01_00101338 predicted 367
5 SASI_Hs01_00101339 predicted 358
6 SASI_Hs01_00101340 predicted 85
7 SASI_Hs01_00101341 predicted 370
8 SASI_Hs01_00101343 predicted 190
9 SASI_Hs02_00344728 predicted 79
10 SASI_Hs01_00101344 predicted 365
11 SASI_Hs01_00101342 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243484 predicted 234
2 SASI_Rn02_00243485 predicted 248
3 SASI_Rn02_00243486 predicted 235
4 SASI_Rn02_00243487 predicted 240
5 SASI_Rn02_00243488 predicted 261
6 SASI_Rn02_00243489 predicted 268
7 SASI_Rn02_00243490 predicted 231
8 SASI_Rn02_00243491 predicted 250
9 SASI_Rn02_00243492 predicted 236
10 SASI_Rn02_00243493 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021774 predicted 292
2 SASI_Mm01_00021776 predicted 364
3 SASI_Mm02_00316313 predicted 368
4 SASI_Mm01_00021777 predicted 325
5 SASI_Mm01_00021778 predicted 269
6 SASI_Mm01_00021779 predicted 355
7 SASI_Mm01_00021780 predicted 320
8 SASI_Mm01_00021781 predicted 377
9 SASI_Mm01_00021782 predicted 323
10 SASI_Mm01_00021783 predicted 374
11 SASI_Mm01_00021775 predicted 339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009514
VPREB3 MISSION shRNA Bacterial Glycerol Stock
pre-B lymphocyte 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-377s1c1
Sequence:CCGGTGCCGATTACTTCTGTTCCATCTCGAGATGGAACAGAAGTAATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009514.2-421s1c1
Sequence:CCGGGCTGGGTTGAACATCTTCTGTCTCGAGACAGAAGATGTTCAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-365s1c1
Sequence:CCGGCCCGGAGGATGATGCCGATTACTCGAGTAATCGGCATCATCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-83s1c1
Sequence:CCGGAGGAACCTTTGTGGCAGTCTTCTCGAGAAGACTGCCACAAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-249s1c1
Sequence:CCGGCTTCTCTACTATTACGCAGAACTCGAGTTCTGCGTAATAGTAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009514.4-158s21c1
Sequence:CCGGCATCTCAGCTGCACCATCAATCTCGAGATTGATGGTGCAGCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009514.4-303s21c1
Sequence:CCGGGATTCTCAGCTACCGTGGATGCTCGAGCATCCACGGTAGCTGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009514.4-260s21c1
Sequence:CCGGTACGCAGAAGAGGAACACTATCTCGAGATAGTGTTCCTCTTCTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009514
VPREB3 MISSION shRNA shRNA Plasmid DNA
pre-B lymphocyte 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-377s1c1
Sequence:CCGGTGCCGATTACTTCTGTTCCATCTCGAGATGGAACAGAAGTAATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009514.2-421s1c1
Sequence:CCGGGCTGGGTTGAACATCTTCTGTCTCGAGACAGAAGATGTTCAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-365s1c1
Sequence:CCGGCCCGGAGGATGATGCCGATTACTCGAGTAATCGGCATCATCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-83s1c1
Sequence:CCGGAGGAACCTTTGTGGCAGTCTTCTCGAGAAGACTGCCACAAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-249s1c1
Sequence:CCGGCTTCTCTACTATTACGCAGAACTCGAGTTCTGCGTAATAGTAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009514.4-158s21c1
Sequence:CCGGCATCTCAGCTGCACCATCAATCTCGAGATTGATGGTGCAGCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009514.4-303s21c1
Sequence:CCGGGATTCTCAGCTACCGTGGATGCTCGAGCATCCACGGTAGCTGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009514.4-260s21c1
Sequence:CCGGTACGCAGAAGAGGAACACTATCTCGAGATAGTGTTCCTCTTCTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009514
VPREB3 MISSION shRNA Lentiviral Transduction Particles
pre-B lymphocyte 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-377s1c1
Sequence:CCGGTGCCGATTACTTCTGTTCCATCTCGAGATGGAACAGAAGTAATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009514.2-421s1c1
Sequence:CCGGGCTGGGTTGAACATCTTCTGTCTCGAGACAGAAGATGTTCAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-365s1c1
Sequence:CCGGCCCGGAGGATGATGCCGATTACTCGAGTAATCGGCATCATCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-83s1c1
Sequence:CCGGAGGAACCTTTGTGGCAGTCTTCTCGAGAAGACTGCCACAAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009514.2-249s1c1
Sequence:CCGGCTTCTCTACTATTACGCAGAACTCGAGTTCTGCGTAATAGTAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009514.4-158s21c1
Sequence:CCGGCATCTCAGCTGCACCATCAATCTCGAGATTGATGGTGCAGCTGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009514.4-303s21c1
Sequence:CCGGGATTCTCAGCTACCGTGGATGCTCGAGCATCCACGGTAGCTGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009514.4-260s21c1
Sequence:CCGGTACGCAGAAGAGGAACACTATCTCGAGATAGTGTTCCTCTTCTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013378
VPREB3 MISSION shRNA Bacterial Glycerol Stock
pre-B lymphocyte 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-425s21c1
Sequence:CCGGCTCTGTTGGCTACGGCTTTAGCTCGAGCTAAAGCCGTAGCCAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-369s21c1
Sequence:CCGGGCCTGTGTCCTCACCATTAGTCTCGAGACTAATGGTGAGGACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-274s21c1
Sequence:CCGGCTCGATATCTCCTCTACTACCCTCGAGGGTAGTAGAGGAGATATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-401s21c1
Sequence:CCGGTGAAGACGACGCGGATTACTACTCGAGTAGTAATCCGCGTCGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-384s21c1
Sequence:CCGGATTAGTCCCGTGCAGCCTGAACTCGAGTTCAGGCTGCACGGGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-176s21c1
Sequence:CCGGAGGCCAAGTGGCTCAACTCTCCTCGAGGAGAGTTGAGCCACTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-224s21c1
Sequence:CCGGCATCAGGGACTACGGTGTGTCCTCGAGGACACACCGTAGTCCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-412s21c1
Sequence:CCGGCGGATTACTACTGCTCTGTTGCTCGAGCAACAGAGCAGTAGTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-125s21c1
Sequence:CCGGGTCAGTTTCCCAGACAGTCCTCTCGAGAGGACTGTCTGGGAAACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013378
VPREB3 MISSION shRNA shRNA Plasmid DNA
pre-B lymphocyte 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-425s21c1
Sequence:CCGGCTCTGTTGGCTACGGCTTTAGCTCGAGCTAAAGCCGTAGCCAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-369s21c1
Sequence:CCGGGCCTGTGTCCTCACCATTAGTCTCGAGACTAATGGTGAGGACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-274s21c1
Sequence:CCGGCTCGATATCTCCTCTACTACCCTCGAGGGTAGTAGAGGAGATATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-401s21c1
Sequence:CCGGTGAAGACGACGCGGATTACTACTCGAGTAGTAATCCGCGTCGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-384s21c1
Sequence:CCGGATTAGTCCCGTGCAGCCTGAACTCGAGTTCAGGCTGCACGGGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-176s21c1
Sequence:CCGGAGGCCAAGTGGCTCAACTCTCCTCGAGGAGAGTTGAGCCACTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-224s21c1
Sequence:CCGGCATCAGGGACTACGGTGTGTCCTCGAGGACACACCGTAGTCCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-412s21c1
Sequence:CCGGCGGATTACTACTGCTCTGTTGCTCGAGCAACAGAGCAGTAGTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-125s21c1
Sequence:CCGGGTCAGTTTCCCAGACAGTCCTCTCGAGAGGACTGTCTGGGAAACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013378
VPREB3 MISSION shRNA Lentiviral Transduction Particles
pre-B lymphocyte 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-425s21c1
Sequence:CCGGCTCTGTTGGCTACGGCTTTAGCTCGAGCTAAAGCCGTAGCCAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-369s21c1
Sequence:CCGGGCCTGTGTCCTCACCATTAGTCTCGAGACTAATGGTGAGGACACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-274s21c1
Sequence:CCGGCTCGATATCTCCTCTACTACCCTCGAGGGTAGTAGAGGAGATATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-401s21c1
Sequence:CCGGTGAAGACGACGCGGATTACTACTCGAGTAGTAATCCGCGTCGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-384s21c1
Sequence:CCGGATTAGTCCCGTGCAGCCTGAACTCGAGTTCAGGCTGCACGGGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-176s21c1
Sequence:CCGGAGGCCAAGTGGCTCAACTCTCCTCGAGGAGAGTTGAGCCACTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-224s21c1
Sequence:CCGGCATCAGGGACTACGGTGTGTCCTCGAGGACACACCGTAGTCCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-412s21c1
Sequence:CCGGCGGATTACTACTGCTCTGTTGCTCGAGCAACAGAGCAGTAGTAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013378.2-125s21c1
Sequence:CCGGGTCAGTTTCCCAGACAGTCCTCTCGAGAGGACTGTCTGGGAAACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks