EMAIL THIS PAGE TO A FRIEND

VPS11

vacuolar protein sorting 11 homolog (S. cerevisiae)

Synonyms: END1 PEP5 RNF108 hVPS11
UniProtKB ID: Q9H270, Q8WY89, Q96EP8, Q9H6D9, Q9HCS6
Gene ID:
Human(55823) Summary: Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps11 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
Mouse(71732) vacuolar protein sorting 11 (yeast)
Rat(315600) vacuolar protein sorting 11 homolog (S. cerevisiae)
Thale Cress(815065) vacuolar protein sorting 11 protein
Horse(100063269) vacuolar protein sorting 11 homolog (S. cerevisiae)
domestic cat(101094875) vacuolar protein sorting 11 homolog (S. cerevisiae)
dog(489374) vacuolar protein sorting 11 homolog (S. cerevisiae)
chicken(419702) vacuolar protein sorting 11 homolog (S. cerevisiae)
Zebrafish(565852) vacuolar protein sorting 11
cow(540381) vacuolar protein sorting 11 homolog (S. cerevisiae)
sheep(101106105) vacuolar protein sorting 11 homolog (S. cerevisiae)
naked mole-rat(101699973) vacuolar protein sorting 11 homolog (S. cerevisiae)
Domestic Rabbit(100358481) vacuolar protein sorting 11 homolog (S. cerevisiae)
domestic guinea pig(100721076) vacuolar protein sorting 11 homolog (S. cerevisiae)
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021729 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021729 Rosetta Predictions human pricing
NM_001108138 Rosetta Predictions rat pricing
NM_027889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355047 predicted 1717
2 SASI_Hs01_00020870 predicted 603
3 SASI_Hs01_00020871 predicted 924
4 SASI_Hs01_00020873 predicted 312
5 SASI_Hs01_00020874 predicted 2668
6 SASI_Hs01_00020875 predicted 595
7 SASI_Hs01_00020876 predicted 2571
8 SASI_Hs01_00020877 predicted 1109
9 SASI_Hs01_00020878 predicted 1138
10 SASI_Hs01_00020879 predicted 840
11 SASI_Hs01_00020872 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235734 predicted 652
2 SASI_Rn02_00235735 predicted 471
3 SASI_Rn02_00235736 predicted 1206
4 SASI_Rn02_00235737 predicted 612
5 SASI_Rn02_00235738 predicted 1310
6 SASI_Rn02_00235739 predicted 2671
7 SASI_Rn02_00235740 predicted 1913
8 SASI_Rn02_00235741 predicted 405
9 SASI_Rn02_00235742 predicted 1541
10 SASI_Rn02_00235743 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130870 predicted 1655
2 SASI_Mm01_00130871 predicted 1199
3 SASI_Mm01_00130872 predicted 526
4 SASI_Mm01_00130873 predicted 2576
5 SASI_Mm01_00130875 predicted 356
6 SASI_Mm01_00130876 predicted 2334
7 SASI_Mm01_00130877 predicted 1484
8 SASI_Mm02_00332857 predicted 1134
9 SASI_Mm01_00130878 predicted 1501
10 SASI_Mm01_00130879 predicted 1561
11 SASI_Mm01_00130874 predicted 1126
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021729
VALIDATED
VPS11 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 11 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021729.4-3017s21c1
Sequence:CCGGCTTTCCCTGCCTTCTTATTTACTCGAGTAAATAAGAAGGCAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-2673s21c1
Sequence:CCGGACGAGATCTCCATGATCAATTCTCGAGAATTGATCATGGAGATCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-667s21c1
Sequence:CCGGGAGAACGTCCAGTCCTATATACTCGAGTATATAGGACTGGACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-1475s21c1
Sequence:CCGGGTGAGAGTGAAGTCCACTTTGCTCGAGCAAAGTGGACTTCACTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-1146s21c1
Sequence:CCGGCCTATTTGAGATGGCGATTAACTCGAGTTAATCGCCATCTCAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-1004s21c1
Sequence:CCGGTAGCCTATAGCACCGTCTTTGCTCGAGCAAAGACGGTGCTATAGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-316s21c1
Sequence:CCGGCAACTGAAGCAGCACAATATTCTCGAGAATATTGTGCTGCTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-2579s1c1
Sequence:CCGGGCTTTGAGAGTTACTCGGAAACTCGAGTTTCCGAGTAACTCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-956s1c1
Sequence:CCGGGCTCCGACAAGCAGATTCTAACTCGAGTTAGAATCTGCTTGTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-2265s1c1
Sequence:CCGGCCTCAAGCATATCGAGAACAACTCGAGTTGTTCTCGATATGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-459s1c1
Sequence:CCGGGCCAACTGTTGTATCTTGTTTCTCGAGAAACAAGATACAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-1131s1c1
Sequence:CCGGGCTGTTTAAGAAGAACCTATTCTCGAGAATAGGTTCTTCTTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021729
VALIDATED
VPS11 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 11 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021729.4-3017s21c1
Sequence:CCGGCTTTCCCTGCCTTCTTATTTACTCGAGTAAATAAGAAGGCAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-2673s21c1
Sequence:CCGGACGAGATCTCCATGATCAATTCTCGAGAATTGATCATGGAGATCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-667s21c1
Sequence:CCGGGAGAACGTCCAGTCCTATATACTCGAGTATATAGGACTGGACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-1475s21c1
Sequence:CCGGGTGAGAGTGAAGTCCACTTTGCTCGAGCAAAGTGGACTTCACTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-1146s21c1
Sequence:CCGGCCTATTTGAGATGGCGATTAACTCGAGTTAATCGCCATCTCAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-1004s21c1
Sequence:CCGGTAGCCTATAGCACCGTCTTTGCTCGAGCAAAGACGGTGCTATAGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-316s21c1
Sequence:CCGGCAACTGAAGCAGCACAATATTCTCGAGAATATTGTGCTGCTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-2579s1c1
Sequence:CCGGGCTTTGAGAGTTACTCGGAAACTCGAGTTTCCGAGTAACTCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-956s1c1
Sequence:CCGGGCTCCGACAAGCAGATTCTAACTCGAGTTAGAATCTGCTTGTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-2265s1c1
Sequence:CCGGCCTCAAGCATATCGAGAACAACTCGAGTTGTTCTCGATATGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-459s1c1
Sequence:CCGGGCCAACTGTTGTATCTTGTTTCTCGAGAAACAAGATACAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-1131s1c1
Sequence:CCGGGCTGTTTAAGAAGAACCTATTCTCGAGAATAGGTTCTTCTTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021729
VALIDATED
VPS11 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 11 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021729.4-3017s21c1
Sequence:CCGGCTTTCCCTGCCTTCTTATTTACTCGAGTAAATAAGAAGGCAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-2673s21c1
Sequence:CCGGACGAGATCTCCATGATCAATTCTCGAGAATTGATCATGGAGATCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-667s21c1
Sequence:CCGGGAGAACGTCCAGTCCTATATACTCGAGTATATAGGACTGGACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-1475s21c1
Sequence:CCGGGTGAGAGTGAAGTCCACTTTGCTCGAGCAAAGTGGACTTCACTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-1146s21c1
Sequence:CCGGCCTATTTGAGATGGCGATTAACTCGAGTTAATCGCCATCTCAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-1004s21c1
Sequence:CCGGTAGCCTATAGCACCGTCTTTGCTCGAGCAAAGACGGTGCTATAGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021729.4-316s21c1
Sequence:CCGGCAACTGAAGCAGCACAATATTCTCGAGAATATTGTGCTGCTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-2579s1c1
Sequence:CCGGGCTTTGAGAGTTACTCGGAAACTCGAGTTTCCGAGTAACTCTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-956s1c1
Sequence:CCGGGCTCCGACAAGCAGATTCTAACTCGAGTTAGAATCTGCTTGTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-2265s1c1
Sequence:CCGGCCTCAAGCATATCGAGAACAACTCGAGTTGTTCTCGATATGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-459s1c1
Sequence:CCGGGCCAACTGTTGTATCTTGTTTCTCGAGAAACAAGATACAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_021729.3-1131s1c1
Sequence:CCGGGCTGTTTAAGAAGAACCTATTCTCGAGAATAGGTTCTTCTTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027889
VALIDATED
VPS11 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 11 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-1555s21c1
Sequence:CCGGGCTGAGAATCATGCACATCATCTCGAGATGATGTGCATGATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-2340s21c1
Sequence:CCGGCCTGTCTATCATCCGAGATTACTCGAGTAATCTCGGATGATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-3034s21c1
Sequence:CCGGCCAGCAGTATAGATTCTTCTACTCGAGTAGAAGAATCTATACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-641s21c1
Sequence:CCGGCCCACTTGTTTGTCGTGACAACTCGAGTTGTCACGACAAACAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027889.1-456s21c2
Sequence:CCGGGCCAACTGTTGTGTCTTGTTTCTCGAGAAACAAGACACAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-3034s1c1
Sequence:CCGGCCAGCAGTATAGATTCTTCTACTCGAGTAGAAGAATCTATACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-456s1c1
Sequence:CCGGGCCAACTGTTGTGTCTTGTTTCTCGAGAAACAAGACACAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-2340s1c1
Sequence:CCGGCCTGTCTATCATCCGAGATTACTCGAGTAATCTCGGATGATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-641s1c1
Sequence:CCGGCCCACTTGTTTGTCGTGACAACTCGAGTTGTCACGACAAACAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-1555s1c1
Sequence:CCGGGCTGAGAATCATGCACATCATCTCGAGATGATGTGCATGATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027889
VALIDATED
VPS11 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 11 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-1555s21c1
Sequence:CCGGGCTGAGAATCATGCACATCATCTCGAGATGATGTGCATGATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-2340s21c1
Sequence:CCGGCCTGTCTATCATCCGAGATTACTCGAGTAATCTCGGATGATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-3034s21c1
Sequence:CCGGCCAGCAGTATAGATTCTTCTACTCGAGTAGAAGAATCTATACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-641s21c1
Sequence:CCGGCCCACTTGTTTGTCGTGACAACTCGAGTTGTCACGACAAACAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027889.1-456s21c2
Sequence:CCGGGCCAACTGTTGTGTCTTGTTTCTCGAGAAACAAGACACAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-3034s1c1
Sequence:CCGGCCAGCAGTATAGATTCTTCTACTCGAGTAGAAGAATCTATACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-456s1c1
Sequence:CCGGGCCAACTGTTGTGTCTTGTTTCTCGAGAAACAAGACACAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-2340s1c1
Sequence:CCGGCCTGTCTATCATCCGAGATTACTCGAGTAATCTCGGATGATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-641s1c1
Sequence:CCGGCCCACTTGTTTGTCGTGACAACTCGAGTTGTCACGACAAACAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-1555s1c1
Sequence:CCGGGCTGAGAATCATGCACATCATCTCGAGATGATGTGCATGATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027889
VALIDATED
VPS11 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 11 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-1555s21c1
Sequence:CCGGGCTGAGAATCATGCACATCATCTCGAGATGATGTGCATGATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-2340s21c1
Sequence:CCGGCCTGTCTATCATCCGAGATTACTCGAGTAATCTCGGATGATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-3034s21c1
Sequence:CCGGCCAGCAGTATAGATTCTTCTACTCGAGTAGAAGAATCTATACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027889.1-641s21c1
Sequence:CCGGCCCACTTGTTTGTCGTGACAACTCGAGTTGTCACGACAAACAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027889.1-456s21c2
Sequence:CCGGGCCAACTGTTGTGTCTTGTTTCTCGAGAAACAAGACACAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-3034s1c1
Sequence:CCGGCCAGCAGTATAGATTCTTCTACTCGAGTAGAAGAATCTATACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-456s1c1
Sequence:CCGGGCCAACTGTTGTGTCTTGTTTCTCGAGAAACAAGACACAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-2340s1c1
Sequence:CCGGCCTGTCTATCATCCGAGATTACTCGAGTAATCTCGGATGATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-641s1c1
Sequence:CCGGCCCACTTGTTTGTCGTGACAACTCGAGTTGTCACGACAAACAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027889.1-1555s1c1
Sequence:CCGGGCTGAGAATCATGCACATCATCTCGAGATGATGTGCATGATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks