EMAIL THIS PAGE TO A FRIEND

VPS13A

vacuolar protein sorting 13 homolog A (S. cerevisiae)

Synonyms: CHAC CHOREIN
Gene ID:
Human(23230) Summary: The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(271564) vacuolar protein sorting 13A (yeast)
Rat(309243) vacuolar protein sorting 13 homolog A (S. cerevisiae)
Zebrafish(378837) vacuolar protein sorting 13 homolog A (S. cerevisiae)
chicken(427050) vacuolar protein sorting 13 homolog A (S. cerevisiae)
dog(476319) vacuolar protein sorting 13 homolog A (S. cerevisiae)
Horse(100063204) vacuolar protein sorting 13 homolog A (S. cerevisiae)
domestic cat(101097678) vacuolar protein sorting 13 homolog A (S. cerevisiae)
domestic guinea pig(100714311) vacuolar protein sorting 13 homolog A (S. cerevisiae)
Domestic Rabbit(100347794) vacuolar protein sorting 13 homolog A (S. cerevisiae)
naked mole-rat(101714122) vacuolar protein sorting 13 homolog A (S. cerevisiae)
cow(100336482) vacuolar protein sorting 13 homolog A (S. cerevisiae)
cow(519494) vacuolar protein sorting 13 homolog A (S. cerevisiae)
sheep(101112545) vacuolar protein sorting 13 homolog A (S. cerevisiae)
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015186 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018037 Rosetta Predictions human pricing
NM_001018038 Rosetta Predictions human pricing
NM_015186 Rosetta Predictions human pricing
NM_033305 Rosetta Predictions human pricing
NM_001100975 Rosetta Predictions rat pricing
NM_173028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197680 predicted 8098
2 SASI_Hs02_00306926 predicted 3756
3 SASI_Hs01_00197681 predicted 4200
4 SASI_Hs01_00197682 predicted 6835
5 SASI_Hs02_00306927 predicted 5126
6 SASI_Hs02_00306928 predicted 6584
7 SASI_Hs01_00197684 predicted 6773
8 SASI_Hs01_00197685 predicted 1646
9 SASI_Hs02_00306929 predicted 4877
10 SASI_Hs01_00197686 predicted 4362
11 SASI_Hs01_00197683 predicted 6654
12 SASI_Hs01_00197687 predicted 3949
13 SASI_Hs01_00197688 predicted 406
14 SASI_Hs01_00197689 predicted 2959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127508 predicted 8221
2 SASI_Hs02_00306930 predicted 3871
3 SASI_Hs01_00127509 predicted 4314
4 SASI_Hs01_00127510 predicted 6959
5 SASI_Hs02_00306931 predicted 5245
6 SASI_Hs02_00306932 predicted 6697
7 SASI_Hs01_00127512 predicted 6898
8 SASI_Hs01_00127513 predicted 1648
9 SASI_Hs02_00306933 predicted 5001
10 SASI_Hs01_00127514 predicted 4471
11 SASI_Hs01_00127511 predicted 6781
12 SASI_Hs01_00127515 predicted 4064
13 SASI_Hs01_00127516 predicted 408
14 SASI_Hs01_00127517 predicted 2959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121781 predicted 8215
2 SASI_Hs02_00347231 predicted 3871
3 SASI_Hs01_00121782 predicted 4321
4 SASI_Hs01_00121783 predicted 6954
5 SASI_Hs02_00347232 predicted 5246
6 SASI_Hs02_00347233 predicted 6702
7 SASI_Hs01_00121785 predicted 6892
8 SASI_Hs01_00121786 predicted 1650
9 SASI_Hs02_00347234 predicted 5000
10 SASI_Hs01_00121787 predicted 4480
11 SASI_Hs01_00121784 predicted 6771
12 SASI_Hs01_00121788 predicted 4058
13 SASI_Hs01_00121789 predicted 406
14 SASI_Hs01_00121790 predicted 2969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152249 predicted 8220
2 SASI_Hs02_00361139 predicted 3867
3 SASI_Hs01_00152250 predicted 4318
4 SASI_Hs01_00152251 predicted 6959
5 SASI_Hs02_00361140 predicted 5246
6 SASI_Hs02_00361141 predicted 6699
7 SASI_Hs01_00152253 predicted 6893
8 SASI_Hs01_00152254 predicted 1647
9 SASI_Hs02_00361142 predicted 5001
10 SASI_Hs01_00152255 predicted 4474
11 SASI_Hs01_00152252 predicted 6773
12 SASI_Hs01_00152256 predicted 4064
13 SASI_Hs01_00152257 predicted 406
14 SASI_Hs01_00152258 predicted 2959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210892 predicted 3229
2 SASI_Rn02_00210893 predicted 1321
3 SASI_Rn02_00210894 predicted 3127
4 SASI_Rn02_00210895 predicted 1618
5 SASI_Rn02_00210896 predicted 3003
6 SASI_Rn02_00210897 predicted 752
7 SASI_Rn02_00210898 predicted 280
8 SASI_Rn02_00210899 predicted 1397
9 SASI_Rn02_00210900 predicted 1596
10 SASI_Rn02_00210901 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145505 predicted 6773
2 SASI_Mm02_00345093 predicted 7981
3 SASI_Mm01_00145507 predicted 3560
4 SASI_Mm01_00145508 predicted 6213
5 SASI_Mm02_00345094 predicted 1002
6 SASI_Mm02_00345095 predicted 578
7 SASI_Mm02_00345096 predicted 5648
8 SASI_Mm01_00145511 predicted 7652
9 SASI_Mm01_00145512 predicted 3061
10 SASI_Mm01_00145513 predicted 765
11 SASI_Mm01_00145506 predicted 1999
12 SASI_Mm01_00145509 predicted 7933
13 SASI_Mm01_00145510 predicted 4733
14 SASI_Mm01_00145514 predicted 8736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015186
VALIDATED
VPS13A MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 13 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015186.1-1160s1c1
Sequence:CCGGGCTTCTTGAATCAGTTGATATCTCGAGATATCAACTGATTCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015186.1-9157s1c1
Sequence:CCGGGCTTAGTTTCTGGATTTGTTACTCGAGTAACAAATCCAGAAACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015186.1-2873s1c1
Sequence:CCGGGCAGGATTGTTCAGTAAATATCTCGAGATATTTACTGAACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015186.1-8614s1c1
Sequence:CCGGGCAGAGAAGAAGCTAAAGATTCTCGAGAATCTTTAGCTTCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015186.1-7447s1c1
Sequence:CCGGCCGAGCATTCTACAGTTATTACTCGAGTAATAACTGTAGAATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015186.1-3521s1c1
Sequence:CCGGGCCTTCAGAAACTGAAATAAACTCGAGTTTATTTCAGTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015186.1-4758s1c1
Sequence:CCGGGCGGTCTTTCAAGAAATGTATCTCGAGATACATTTCTTGAAAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015186.3-7737s21c1
Sequence:GTACCGGGAAGGTTTACAACGCATTATTCTCGAGAATAATGCGTTGTAAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015186.3-6958s21c1
Sequence:GTACCGGATCGAAAGCATCCACCTAATTCTCGAGAATTAGGTGGATGCTTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015186.3-1306s21c1
Sequence:GTACCGGTGTGGTCATGGAAGCATATTACTCGAGTAATATGCTTCCATGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015186
VALIDATED
VPS13A MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 13 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015186.1-1160s1c1
Sequence:CCGGGCTTCTTGAATCAGTTGATATCTCGAGATATCAACTGATTCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015186.1-9157s1c1
Sequence:CCGGGCTTAGTTTCTGGATTTGTTACTCGAGTAACAAATCCAGAAACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015186.1-2873s1c1
Sequence:CCGGGCAGGATTGTTCAGTAAATATCTCGAGATATTTACTGAACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015186.1-8614s1c1
Sequence:CCGGGCAGAGAAGAAGCTAAAGATTCTCGAGAATCTTTAGCTTCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015186.1-7447s1c1
Sequence:CCGGCCGAGCATTCTACAGTTATTACTCGAGTAATAACTGTAGAATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015186.1-3521s1c1
Sequence:CCGGGCCTTCAGAAACTGAAATAAACTCGAGTTTATTTCAGTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015186.1-4758s1c1
Sequence:CCGGGCGGTCTTTCAAGAAATGTATCTCGAGATACATTTCTTGAAAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015186.3-7737s21c1
Sequence:GTACCGGGAAGGTTTACAACGCATTATTCTCGAGAATAATGCGTTGTAAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015186.3-6958s21c1
Sequence:GTACCGGATCGAAAGCATCCACCTAATTCTCGAGAATTAGGTGGATGCTTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015186.3-1306s21c1
Sequence:GTACCGGTGTGGTCATGGAAGCATATTACTCGAGTAATATGCTTCCATGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015186
VALIDATED
VPS13A MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 13 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015186.1-1160s1c1
Sequence:CCGGGCTTCTTGAATCAGTTGATATCTCGAGATATCAACTGATTCAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015186.1-9157s1c1
Sequence:CCGGGCTTAGTTTCTGGATTTGTTACTCGAGTAACAAATCCAGAAACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015186.1-2873s1c1
Sequence:CCGGGCAGGATTGTTCAGTAAATATCTCGAGATATTTACTGAACAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015186.1-8614s1c1
Sequence:CCGGGCAGAGAAGAAGCTAAAGATTCTCGAGAATCTTTAGCTTCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015186.1-7447s1c1
Sequence:CCGGCCGAGCATTCTACAGTTATTACTCGAGTAATAACTGTAGAATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015186.1-3521s1c1
Sequence:CCGGGCCTTCAGAAACTGAAATAAACTCGAGTTTATTTCAGTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015186.1-4758s1c1
Sequence:CCGGGCGGTCTTTCAAGAAATGTATCTCGAGATACATTTCTTGAAAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015186.3-7737s21c1
Sequence:GTACCGGGAAGGTTTACAACGCATTATTCTCGAGAATAATGCGTTGTAAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015186.3-6958s21c1
Sequence:GTACCGGATCGAAAGCATCCACCTAATTCTCGAGAATTAGGTGGATGCTTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015186.3-1306s21c1
Sequence:GTACCGGTGTGGTCATGGAAGCATATTACTCGAGTAATATGCTTCCATGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173028
VALIDATED
VPS13A MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 13 homolog A (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173028.1-3056s1c1
Sequence:CCGGGCGATGGTTCAGGAAATCAAACTCGAGTTTGATTTCCTGAACCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173028.1-1491s1c1
Sequence:CCGGCGGGATTTCACTTGTCAATAACTCGAGTTATTGACAAGTGAAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173028.1-1292s1c1
Sequence:CCGGGCTATGGTGAAGTAACCCATACTCGAGTATGGGTTACTTCACCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173028.1-949s1c1
Sequence:CCGGGCCTCCAATATTCTTCTTATTCTCGAGAATAAGAAGAATATTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173028.1-1129s1c1
Sequence:CCGGGCAGCTACATTCCTATTAATACTCGAGTATTAATAGGAATGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173028.1-1939s1c1
Sequence:CCGGCCGTTTACAGATGTCAGTATTCTCGAGAATACTGACATCTGTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173028.3-7613s21c1
Sequence:GTACCGGTGAAGGCCTGCAGCGTATTATCTCGAGATAATACGCTGCAGGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173028.3-6836s21c1
Sequence:GTACCGGCCGAAAGCATCCACCTAATTACTCGAGTAATTAGGTGGATGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173028.3-5442s21c1
Sequence:GTACCGGGAACTGGAAGTTCACTATTATCTCGAGATAATAGTGAACTTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173028
VALIDATED
VPS13A MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 13 homolog A (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173028.1-3056s1c1
Sequence:CCGGGCGATGGTTCAGGAAATCAAACTCGAGTTTGATTTCCTGAACCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173028.1-1491s1c1
Sequence:CCGGCGGGATTTCACTTGTCAATAACTCGAGTTATTGACAAGTGAAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173028.1-1292s1c1
Sequence:CCGGGCTATGGTGAAGTAACCCATACTCGAGTATGGGTTACTTCACCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173028.1-949s1c1
Sequence:CCGGGCCTCCAATATTCTTCTTATTCTCGAGAATAAGAAGAATATTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173028.1-1129s1c1
Sequence:CCGGGCAGCTACATTCCTATTAATACTCGAGTATTAATAGGAATGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173028.1-1939s1c1
Sequence:CCGGCCGTTTACAGATGTCAGTATTCTCGAGAATACTGACATCTGTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173028.3-7613s21c1
Sequence:GTACCGGTGAAGGCCTGCAGCGTATTATCTCGAGATAATACGCTGCAGGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173028.3-6836s21c1
Sequence:GTACCGGCCGAAAGCATCCACCTAATTACTCGAGTAATTAGGTGGATGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173028.3-5442s21c1
Sequence:GTACCGGGAACTGGAAGTTCACTATTATCTCGAGATAATAGTGAACTTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173028
VALIDATED
VPS13A MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 13 homolog A (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173028.1-3056s1c1
Sequence:CCGGGCGATGGTTCAGGAAATCAAACTCGAGTTTGATTTCCTGAACCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173028.1-1491s1c1
Sequence:CCGGCGGGATTTCACTTGTCAATAACTCGAGTTATTGACAAGTGAAATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173028.1-1292s1c1
Sequence:CCGGGCTATGGTGAAGTAACCCATACTCGAGTATGGGTTACTTCACCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173028.1-949s1c1
Sequence:CCGGGCCTCCAATATTCTTCTTATTCTCGAGAATAAGAAGAATATTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173028.1-1129s1c1
Sequence:CCGGGCAGCTACATTCCTATTAATACTCGAGTATTAATAGGAATGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173028.1-1939s1c1
Sequence:CCGGCCGTTTACAGATGTCAGTATTCTCGAGAATACTGACATCTGTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173028.3-7613s21c1
Sequence:GTACCGGTGAAGGCCTGCAGCGTATTATCTCGAGATAATACGCTGCAGGCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173028.3-6836s21c1
Sequence:GTACCGGCCGAAAGCATCCACCTAATTACTCGAGTAATTAGGTGGATGCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173028.3-5442s21c1
Sequence:GTACCGGGAACTGGAAGTTCACTATTATCTCGAGATAATAGTGAACTTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks