EMAIL THIS PAGE TO A FRIEND

VPS13B

vacuolar protein sorting 13 homolog B (yeast)

Synonyms: CHS1 COH1
Gene ID:
Human(157680) Summary: This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(666173) vacuolar protein sorting 13B (yeast)
Rat(315036) vacuolar protein sorting 13 homolog B (yeast)
chicken(420242) vacuolar protein sorting 13 homolog B (yeast)
dog(481981) vacuolar protein sorting 13 homolog B (yeast)
Horse(100055772) vacuolar protein sorting 13 homolog B (yeast)
domestic cat(101096636) vacuolar protein sorting 13 homolog B (yeast)
cow(512656) vacuolar protein sorting 13 homolog B (yeast)
sheep(101104761) vacuolar protein sorting 13 homolog B (yeast)
naked mole-rat(101712038) vacuolar protein sorting 13 homolog B (yeast)
Domestic Rabbit(100358079) vacuolar protein sorting 13 homolog B (yeast)
domestic guinea pig(100735249) vacuolar protein sorting 13 homolog B (yeast)
195 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015243 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015243 Rosetta Predictions human pricing
NM_017890 Rosetta Predictions human pricing
NM_152564 Rosetta Predictions human pricing
NM_181661 Rosetta Predictions human pricing
NM_001134886 Rosetta Predictions rat pricing
XM_001058951 Rosetta Predictions rat pricing
NM_177151 Rosetta Predictions mouse pricing
XM_986391 Rosetta Predictions mouse pricing
XM_986423 Rosetta Predictions mouse pricing
XM_986454 Rosetta Predictions mouse pricing
XM_986486 Rosetta Predictions mouse pricing
XM_986525 Rosetta Predictions mouse pricing
XM_986559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076702 predicted 916
2 SASI_Hs01_00076703 predicted 522
3 SASI_Hs02_00347378 predicted 462
4 SASI_Hs01_00076704 predicted 940
5 SASI_Hs01_00076705 predicted 911
6 SASI_Hs01_00076707 predicted 727
7 SASI_Hs01_00076708 predicted 679
8 SASI_Hs01_00076710 predicted 531
9 SASI_Hs01_00076711 predicted 250
10 SASI_Hs02_00347379 predicted 377
11 SASI_Hs01_00076706 predicted 740
12 SASI_Hs01_00076709 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214900 predicted 921
2 SASI_Hs01_00214901 predicted 520
3 SASI_Hs02_00350847 predicted 459
4 SASI_Hs01_00214902 predicted 940
5 SASI_Hs01_00214903 predicted 910
6 SASI_Hs01_00214905 predicted 729
7 SASI_Hs01_00214906 predicted 672
8 SASI_Hs01_00214908 predicted 535
9 SASI_Hs01_00214909 predicted 251
10 SASI_Hs02_00350848 predicted 377
11 SASI_Hs01_00214904 predicted 742
12 SASI_Hs01_00214907 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182910 predicted 918
2 SASI_Hs01_00182911 predicted 521
3 SASI_Hs02_00366379 predicted 458
4 SASI_Hs01_00182912 predicted 945
5 SASI_Hs01_00182913 predicted 907
6 SASI_Hs01_00182915 predicted 723
7 SASI_Hs01_00182916 predicted 673
8 SASI_Hs01_00182918 predicted 537
9 SASI_Hs01_00182919 predicted 253
10 SASI_Hs02_00366380 predicted 376
11 SASI_Hs01_00182914 predicted 734
12 SASI_Hs01_00182917 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162886 predicted 918
2 SASI_Hs01_00162887 predicted 519
3 SASI_Hs02_00370255 predicted 461
4 SASI_Hs01_00162888 predicted 948
5 SASI_Hs01_00162889 predicted 915
6 SASI_Hs01_00162891 predicted 724
7 SASI_Hs01_00162892 predicted 680
8 SASI_Hs01_00162894 predicted 530
9 SASI_Hs01_00162895 predicted 258
10 SASI_Hs02_00370256 predicted 378
11 SASI_Hs01_00162890 predicted 736
12 SASI_Hs01_00162893 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258984 predicted 7459
2 SASI_Rn02_00258985 predicted 3938
3 SASI_Rn02_00258986 predicted 1225
4 SASI_Rn02_00258987 predicted 9874
5 SASI_Rn02_00258988 predicted 12141
6 SASI_Rn02_00258989 predicted 9491
7 SASI_Rn02_00258990 predicted 5874
8 SASI_Rn02_00258991 predicted 1543
9 SASI_Rn02_00258992 predicted 311
10 SASI_Rn02_00258993 predicted 7971
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291383 predicted 7462
2 SASI_Rn02_00291384 predicted 3943
3 SASI_Rn02_00291385 predicted 1226
4 SASI_Rn02_00291386 predicted 9873
5 SASI_Rn02_00291387 predicted 12140
6 SASI_Rn02_00291388 predicted 9490
7 SASI_Rn02_00291389 predicted 5871
8 SASI_Rn02_00291390 predicted 1545
9 SASI_Rn02_00291391 predicted 308
10 SASI_Rn02_00291392 predicted 7976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347141 predicted 8348
2 SASI_Mm02_00347142 predicted 7456
3 SASI_Mm02_00347143 predicted 7973
4 SASI_Mm02_00347144 predicted 9495
5 SASI_Mm02_00347145 predicted 11463
6 SASI_Mm02_00347146 predicted 5877
7 SASI_Mm02_00347147 predicted 376
8 SASI_Mm02_00347148 predicted 1544
9 SASI_Mm02_00347149 predicted 1309
10 SASI_Mm02_00347150 predicted 8915
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231583 predicted 1587
2 SASI_Mm01_00231584 predicted 2018
3 SASI_Mm01_00231585 predicted 1178
4 SASI_Mm01_00231586 predicted 1179
5 SASI_Mm01_00231587 predicted 1169
6 SASI_Mm01_00231588 predicted 1801
7 SASI_Mm01_00231589 predicted 1392
8 SASI_Mm01_00231590 predicted 1633
9 SASI_Mm01_00231591 predicted 1829
10 SASI_Mm01_00231592 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269366 predicted 757
2 SASI_Mm01_00269367 predicted 829
3 SASI_Mm01_00269368 predicted 790
4 SASI_Mm01_00269369 predicted 879
5 SASI_Mm01_00269370 predicted 899
6 SASI_Mm01_00269371 predicted 903
7 SASI_Mm01_00269372 predicted 840
8 SASI_Mm01_00269373 predicted 820
9 SASI_Mm01_00269374 predicted 842
10 SASI_Mm01_00269375 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220139 predicted 1466
2 SASI_Mm01_00220140 predicted 1899
3 SASI_Mm01_00220141 predicted 1059
4 SASI_Mm01_00220142 predicted 1043
5 SASI_Mm01_00220143 predicted 1674
6 SASI_Mm01_00220144 predicted 1269
7 SASI_Mm01_00220145 predicted 881
8 SASI_Mm01_00220146 predicted 1513
9 SASI_Mm01_00220147 predicted 1700
10 SASI_Mm01_00220148 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277549 predicted 1462
2 SASI_Mm01_00277550 predicted 4103
3 SASI_Mm01_00277551 predicted 2566
4 SASI_Mm01_00277552 predicted 2762
5 SASI_Mm01_00277553 predicted 1049
6 SASI_Mm01_00277554 predicted 1266
7 SASI_Mm01_00277555 predicted 889
8 SASI_Mm01_00277556 predicted 1941
9 SASI_Mm01_00277557 predicted 1709
10 SASI_Mm01_00277558 predicted 4329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205863 predicted 8736
2 SASI_Mm01_00205864 predicted 7851
3 SASI_Mm01_00205865 predicted 8366
4 SASI_Mm01_00205866 predicted 9879
5 SASI_Mm01_00205867 predicted 11858
6 SASI_Mm01_00205868 predicted 6697
7 SASI_Mm01_00205869 predicted 6271
8 SASI_Mm01_00205870 predicted 1934
9 SASI_Mm01_00205871 predicted 1703
10 SASI_Mm01_00205872 predicted 4331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239146 predicted 2499
2 SASI_Mm01_00239147 predicted 1935
3 SASI_Mm01_00239148 predicted 2208
4 SASI_Mm01_00239149 predicted 765
5 SASI_Mm01_00239150 predicted 2410
6 SASI_Mm01_00239151 predicted 1694
7 SASI_Mm01_00239152 predicted 2075
8 SASI_Mm01_00239153 predicted 2378
9 SASI_Mm01_00239154 predicted 835
10 SASI_Mm01_00239155 predicted 2082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015243
VALIDATED
VPS13B MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 13 homolog B (yeast)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015243.2-2371s21c1
Sequence:GTACCGGTGCTTACCTGTACCAGTTATTCTCGAGAATAACTGGTACAGGTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015243.2-1329s21c1
Sequence:GTACCGGGCAAGTTGAGAGTAGTTATTACTCGAGTAATAACTACTCTCAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015243.2-1631s21c1
Sequence:GTACCGGATGGTACTCGCGCAGAATTTACTCGAGTAAATTCTGCGCGAGTACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015243.2-2261s1c1
Sequence:CCGGGCCTTACTCAACCTTCTGATACTCGAGTATCAGAAGGTTGAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015243.2-182s1c1
Sequence:CCGGCGGATCTACAGCTTTCACTATCTCGAGATAGTGAAAGCTGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015243.2-2262s1c1
Sequence:CCGGCCTTACTCAACCTTCTGATAACTCGAGTTATCAGAAGGTTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015243.2-1639s1c1
Sequence:CCGGCGCGCAGAATTTATCTTGGATCTCGAGATCCAAGATAAATTCTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015243.2-922s1c1
Sequence:CCGGCTGCCTATGTTTATTCGTATACTCGAGTATACGAATAAACATAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015243
VALIDATED
VPS13B MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 13 homolog B (yeast)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015243.2-2371s21c1
Sequence:GTACCGGTGCTTACCTGTACCAGTTATTCTCGAGAATAACTGGTACAGGTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015243.2-1329s21c1
Sequence:GTACCGGGCAAGTTGAGAGTAGTTATTACTCGAGTAATAACTACTCTCAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015243.2-1631s21c1
Sequence:GTACCGGATGGTACTCGCGCAGAATTTACTCGAGTAAATTCTGCGCGAGTACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015243.2-2261s1c1
Sequence:CCGGGCCTTACTCAACCTTCTGATACTCGAGTATCAGAAGGTTGAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015243.2-182s1c1
Sequence:CCGGCGGATCTACAGCTTTCACTATCTCGAGATAGTGAAAGCTGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015243.2-2262s1c1
Sequence:CCGGCCTTACTCAACCTTCTGATAACTCGAGTTATCAGAAGGTTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015243.2-1639s1c1
Sequence:CCGGCGCGCAGAATTTATCTTGGATCTCGAGATCCAAGATAAATTCTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015243.2-922s1c1
Sequence:CCGGCTGCCTATGTTTATTCGTATACTCGAGTATACGAATAAACATAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015243
VALIDATED
VPS13B MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 13 homolog B (yeast)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015243.2-2371s21c1
Sequence:GTACCGGTGCTTACCTGTACCAGTTATTCTCGAGAATAACTGGTACAGGTAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015243.2-1329s21c1
Sequence:GTACCGGGCAAGTTGAGAGTAGTTATTACTCGAGTAATAACTACTCTCAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015243.2-1631s21c1
Sequence:GTACCGGATGGTACTCGCGCAGAATTTACTCGAGTAAATTCTGCGCGAGTACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015243.2-2261s1c1
Sequence:CCGGGCCTTACTCAACCTTCTGATACTCGAGTATCAGAAGGTTGAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015243.2-182s1c1
Sequence:CCGGCGGATCTACAGCTTTCACTATCTCGAGATAGTGAAAGCTGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015243.2-2262s1c1
Sequence:CCGGCCTTACTCAACCTTCTGATAACTCGAGTTATCAGAAGGTTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015243.2-1639s1c1
Sequence:CCGGCGCGCAGAATTTATCTTGGATCTCGAGATCCAAGATAAATTCTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015243.2-922s1c1
Sequence:CCGGCTGCCTATGTTTATTCGTATACTCGAGTATACGAATAAACATAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177151
VALIDATED
VPS13B MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 13 homolog B (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177151.3-12507s21c1
Sequence:CCGGTAGTGATCTGCATATAGTAAACTCGAGTTTACTATATGCAGATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177151.3-6183s21c1
Sequence:CCGGCCCGAAGCTTCTGACTATAACCTCGAGGTTATAGTCAGAAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177151.3-817s21c1
Sequence:CCGGATCGTGCATTCATGGATATTTCTCGAGAAATATCCATGAATGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177151.3-4794s21c1
Sequence:CCGGACGCTGACTTCACGCAATTTACTCGAGTAAATTGCGTGAAGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177151.3-1073s21c1
Sequence:CCGGACCTATGTTTATCCGTATAATCTCGAGATTATACGGATAAACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177151
VALIDATED
VPS13B MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 13 homolog B (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177151.3-12507s21c1
Sequence:CCGGTAGTGATCTGCATATAGTAAACTCGAGTTTACTATATGCAGATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177151.3-6183s21c1
Sequence:CCGGCCCGAAGCTTCTGACTATAACCTCGAGGTTATAGTCAGAAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177151.3-817s21c1
Sequence:CCGGATCGTGCATTCATGGATATTTCTCGAGAAATATCCATGAATGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177151.3-4794s21c1
Sequence:CCGGACGCTGACTTCACGCAATTTACTCGAGTAAATTGCGTGAAGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177151.3-1073s21c1
Sequence:CCGGACCTATGTTTATCCGTATAATCTCGAGATTATACGGATAAACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177151
VALIDATED
VPS13B MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 13 homolog B (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177151.3-12507s21c1
Sequence:CCGGTAGTGATCTGCATATAGTAAACTCGAGTTTACTATATGCAGATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177151.3-6183s21c1
Sequence:CCGGCCCGAAGCTTCTGACTATAACCTCGAGGTTATAGTCAGAAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177151.3-817s21c1
Sequence:CCGGATCGTGCATTCATGGATATTTCTCGAGAAATATCCATGAATGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177151.3-4794s21c1
Sequence:CCGGACGCTGACTTCACGCAATTTACTCGAGTAAATTGCGTGAAGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177151.3-1073s21c1
Sequence:CCGGACCTATGTTTATCCGTATAATCTCGAGATTATACGGATAAACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks