EMAIL THIS PAGE TO A FRIEND

VPS13C

vacuolar protein sorting 13 homolog C (S. cerevisiae)

Gene ID:
Human(54832) Summary: This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Mouse(320528) vacuolar protein sorting 13C (yeast)
Rat(363087) vacuolar protein sorting 13 homolog C (S. cerevisiae)
domestic guinea pig(100726528) vacuolar protein sorting 13 homolog C (S. cerevisiae)
Domestic Rabbit(100355887) vacuolar protein sorting 13 homolog C (S. cerevisiae)
naked mole-rat(101720217) vacuolar protein sorting 13 homolog C (S. cerevisiae)
cow(783566) vacuolar protein sorting 13 homolog C (S. cerevisiae)
sheep(101112983) vacuolar protein sorting 13 homolog C (S. cerevisiae)
chicken(415376) vacuolar protein sorting 13 homolog C (S. cerevisiae)
domestic cat(101099469) vacuolar protein sorting 13 homolog C (S. cerevisiae)
dog(487586) vacuolar protein sorting 13 homolog C (S. cerevisiae)
243 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017684 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018088 Rosetta Predictions human pricing
NM_017684 Rosetta Predictions human pricing
NM_018080 Rosetta Predictions human pricing
NM_020821 Rosetta Predictions human pricing
XM_343418 Rosetta Predictions rat pricing
XR_007475 Rosetta Predictions rat pricing
NM_177184 Rosetta Predictions mouse pricing
XM_620758 Rosetta Predictions mouse pricing
XM_899828 Rosetta Predictions mouse pricing
XM_899842 Rosetta Predictions mouse pricing
XM_899849 Rosetta Predictions mouse pricing
XM_899856 Rosetta Predictions mouse pricing
XM_899860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077418 predicted 4223
2 SASI_Hs01_00077421 predicted 1870
3 SASI_Hs01_00077422 predicted 7118
4 SASI_Hs02_00306995 predicted 2382
5 SASI_Hs01_00077423 predicted 10221
6 SASI_Hs02_00306996 predicted 7760
7 SASI_Hs01_00077424 predicted 9590
8 SASI_Hs01_00077425 predicted 1784
9 SASI_Hs02_00306997 predicted 8902
10 SASI_Hs02_00306998 predicted 9403
11 SASI_Hs01_00077419 predicted 6149
12 SASI_Hs01_00077420 predicted 820
13 SASI_Hs01_00077426 predicted 7610
14 SASI_Hs01_00077427 predicted 10264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173776 predicted 4092
2 SASI_Hs01_00173779 predicted 1750
3 SASI_Hs01_00173780 predicted 6989
4 SASI_Hs02_00350434 predicted 2250
5 SASI_Hs01_00173781 predicted 10091
6 SASI_Hs02_00350435 predicted 7637
7 SASI_Hs01_00173782 predicted 9464
8 SASI_Hs01_00173783 predicted 1652
9 SASI_Hs02_00350436 predicted 8771
10 SASI_Hs02_00350437 predicted 9273
11 SASI_Hs01_00173777 predicted 6023
12 SASI_Hs01_00173778 predicted 693
13 SASI_Hs01_00173784 predicted 7476
14 SASI_Hs01_00173785 predicted 10135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193617 predicted 4095
2 SASI_Hs01_00193620 predicted 1745
3 SASI_Hs01_00193621 predicted 6982
4 SASI_Hs02_00351234 predicted 2253
5 SASI_Hs01_00193622 predicted 10089
6 SASI_Hs02_00351235 predicted 7635
7 SASI_Hs01_00193623 predicted 9461
8 SASI_Hs01_00193624 predicted 1657
9 SASI_Hs02_00351236 predicted 8765
10 SASI_Hs02_00351237 predicted 9270
11 SASI_Hs01_00193618 predicted 6017
12 SASI_Hs01_00193619 predicted 690
13 SASI_Hs01_00193625 predicted 7478
14 SASI_Hs01_00193626 predicted 10138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139987 predicted 4219
2 SASI_Hs01_00139990 predicted 1871
3 SASI_Hs01_00139991 predicted 7118
4 SASI_Hs02_00354034 predicted 2380
5 SASI_Hs01_00139992 predicted 10212
6 SASI_Hs02_00354035 predicted 7761
7 SASI_Hs01_00139993 predicted 9589
8 SASI_Hs01_00139994 predicted 1783
9 SASI_Hs02_00354036 predicted 8902
10 SASI_Hs02_00354037 predicted 9398
11 SASI_Hs01_00139988 predicted 6155
12 SASI_Hs01_00139989 predicted 821
13 SASI_Hs01_00139995 predicted 7605
14 SASI_Hs01_00139996 predicted 10265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395754 predicted 3604
2 SASI_Rn02_00395755 predicted 3833
3 SASI_Rn02_00395756 predicted 1189
4 SASI_Rn02_00395757 predicted 3975
5 SASI_Rn02_00395758 predicted 4257
6 SASI_Rn02_00395759 predicted 1364
7 SASI_Rn02_00395760 predicted 9623
8 SASI_Rn02_00395761 predicted 5899
9 SASI_Rn02_00395762 predicted 8431
10 SASI_Rn02_00395763 predicted 9122
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190888 predicted 3763
2 SASI_Rn02_00414680 predicted 3994
3 SASI_Rn02_00414681 predicted 1392
4 SASI_Rn01_00190889 predicted 4136
5 SASI_Rn01_00190890 predicted 4423
6 SASI_Rn01_00190891 predicted 1570
7 SASI_Rn01_00190892 predicted 10132
8 SASI_Rn02_00414682 predicted 6059
9 SASI_Rn01_00190894 predicted 11648
10 SASI_Rn01_00190895 predicted 8931
11 SASI_Rn01_00190893 predicted 8016
12 SASI_Rn01_00190896 predicted 8807
13 SASI_Rn01_00190897 predicted 8243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347170 predicted 8170
2 SASI_Mm02_00347171 predicted 4027
3 SASI_Mm02_00347172 predicted 1432
4 SASI_Mm02_00347173 predicted 8571
5 SASI_Mm02_00347174 predicted 10866
6 SASI_Mm02_00347175 predicted 7167
7 SASI_Mm02_00347176 predicted 10161
8 SASI_Mm02_00347177 predicted 209
9 SASI_Mm02_00347178 predicted 9651
10 SASI_Mm02_00347179 predicted 3339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263137 predicted 8034
2 SASI_Mm01_00263138 predicted 8172
3 SASI_Mm01_00263139 predicted 4029
4 SASI_Mm01_00263140 predicted 1425
5 SASI_Mm01_00263141 predicted 7164
6 SASI_Mm01_00263142 predicted 10153
7 SASI_Mm01_00263143 predicted 201
8 SASI_Mm01_00263144 predicted 8324
9 SASI_Mm01_00263145 predicted 3346
10 SASI_Mm01_00263146 predicted 1682
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257908 predicted 1038
2 SASI_Mm01_00257909 predicted 2202
3 SASI_Mm01_00257910 predicted 475
4 SASI_Mm01_00257911 predicted 1498
5 SASI_Mm01_00257912 predicted 1154
6 SASI_Mm01_00257913 predicted 2285
7 SASI_Mm01_00257914 predicted 1001
8 SASI_Mm01_00257915 predicted 1083
9 SASI_Mm01_00257916 predicted 1256
10 SASI_Mm01_00257917 predicted 2311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239302 predicted 232
2 SASI_Mm01_00239303 predicted 235
3 SASI_Mm01_00239304 predicted 277
4 SASI_Mm01_00239305 predicted 281
5 SASI_Mm01_00239306 predicted 272
6 SASI_Mm01_00239307 predicted 276
7 SASI_Mm01_00239308 predicted 280
8 SASI_Mm01_00239309 predicted 279
9 SASI_Mm01_00239310 predicted 461
10 SASI_Mm01_00239311 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248601 predicted 8040
2 SASI_Mm01_00248602 predicted 8169
3 SASI_Mm01_00248603 predicted 4027
4 SASI_Mm01_00248604 predicted 1423
5 SASI_Mm01_00248605 predicted 7158
6 SASI_Mm01_00248606 predicted 10154
7 SASI_Mm01_00248607 predicted 210
8 SASI_Mm01_00248608 predicted 8318
9 SASI_Mm01_00248609 predicted 3338
10 SASI_Mm01_00248610 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256533 predicted 211
2 SASI_Mm01_00256534 predicted 959
3 SASI_Mm01_00256535 predicted 241
4 SASI_Mm01_00256536 predicted 308
5 SASI_Mm01_00256537 predicted 957
6 SASI_Mm01_00256538 predicted 540
7 SASI_Mm01_00256539 predicted 685
8 SASI_Mm01_00256540 predicted 132
9 SASI_Mm01_00256541 predicted 256
10 SASI_Mm01_00256542 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245320 predicted 7888
2 SASI_Mm01_00245321 predicted 8016
3 SASI_Mm01_00245322 predicted 3874
4 SASI_Mm01_00245323 predicted 1274
5 SASI_Mm01_00245324 predicted 10707
6 SASI_Mm01_00245325 predicted 7013
7 SASI_Mm01_00245326 predicted 10000
8 SASI_Mm01_00245327 predicted 8168
9 SASI_Mm01_00245328 predicted 3191
10 SASI_Mm01_00245329 predicted 1535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017684
VALIDATED
VPS13C MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 13 homolog C (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017684.3-13076s1c1
Sequence:CCGGGCTGTTGACAATGTCCCATATCTCGAGATATGGGACATTGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_017684.3-9831s1c1
Sequence:CCGGCGGACAAAGTTAATCCAACAACTCGAGTTGTTGGATTAACTTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017684.3-11500s1c1
Sequence:CCGGGCAAAGGTCAATAGGCTTATACTCGAGTATAAGCCTATTGACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017684.3-12834s1c1
Sequence:CCGGGCAGTAACTAATGCCCTAAATCTCGAGATTTAGGGCATTAGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017684.3-1505s1c1
Sequence:CCGGCCTAACTTTACCTAAGCAGTACTCGAGTACTGCTTAGGTAAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-314s21c1
Sequence:CCGGTGCGACCCTGGAAGGATTATACTCGAGTATAATCCTTCCAGGGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017684.3-13078s21c1
Sequence:CCGGTGTTGACAATGTCCCATATATCTCGAGATATATGGGACATTGTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-9464s21c1
Sequence:CCGGCCCTATTCGTAGCCCTATTAACTCGAGTTAATAGGGCTACGAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-1662s21c1
Sequence:CCGGCTTAAGGTAGAAGCGAAATTACTCGAGTAATTTCGCTTCTACCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-1520s21c1
Sequence:CCGGGCAGTATGTTGCCCATATTATCTCGAGATAATATGGGCAACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017684
VALIDATED
VPS13C MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 13 homolog C (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017684.3-13076s1c1
Sequence:CCGGGCTGTTGACAATGTCCCATATCTCGAGATATGGGACATTGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_017684.3-9831s1c1
Sequence:CCGGCGGACAAAGTTAATCCAACAACTCGAGTTGTTGGATTAACTTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017684.3-11500s1c1
Sequence:CCGGGCAAAGGTCAATAGGCTTATACTCGAGTATAAGCCTATTGACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017684.3-12834s1c1
Sequence:CCGGGCAGTAACTAATGCCCTAAATCTCGAGATTTAGGGCATTAGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017684.3-1505s1c1
Sequence:CCGGCCTAACTTTACCTAAGCAGTACTCGAGTACTGCTTAGGTAAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-314s21c1
Sequence:CCGGTGCGACCCTGGAAGGATTATACTCGAGTATAATCCTTCCAGGGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017684.3-13078s21c1
Sequence:CCGGTGTTGACAATGTCCCATATATCTCGAGATATATGGGACATTGTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-9464s21c1
Sequence:CCGGCCCTATTCGTAGCCCTATTAACTCGAGTTAATAGGGCTACGAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-1662s21c1
Sequence:CCGGCTTAAGGTAGAAGCGAAATTACTCGAGTAATTTCGCTTCTACCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-1520s21c1
Sequence:CCGGGCAGTATGTTGCCCATATTATCTCGAGATAATATGGGCAACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017684
VALIDATED
VPS13C MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 13 homolog C (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017684.3-13076s1c1
Sequence:CCGGGCTGTTGACAATGTCCCATATCTCGAGATATGGGACATTGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_017684.3-9831s1c1
Sequence:CCGGCGGACAAAGTTAATCCAACAACTCGAGTTGTTGGATTAACTTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017684.3-11500s1c1
Sequence:CCGGGCAAAGGTCAATAGGCTTATACTCGAGTATAAGCCTATTGACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017684.3-12834s1c1
Sequence:CCGGGCAGTAACTAATGCCCTAAATCTCGAGATTTAGGGCATTAGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017684.3-1505s1c1
Sequence:CCGGCCTAACTTTACCTAAGCAGTACTCGAGTACTGCTTAGGTAAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-314s21c1
Sequence:CCGGTGCGACCCTGGAAGGATTATACTCGAGTATAATCCTTCCAGGGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017684.3-13078s21c1
Sequence:CCGGTGTTGACAATGTCCCATATATCTCGAGATATATGGGACATTGTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-9464s21c1
Sequence:CCGGCCCTATTCGTAGCCCTATTAACTCGAGTTAATAGGGCTACGAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-1662s21c1
Sequence:CCGGCTTAAGGTAGAAGCGAAATTACTCGAGTAATTTCGCTTCTACCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017684.3-1520s21c1
Sequence:CCGGGCAGTATGTTGCCCATATTATCTCGAGATAATATGGGCAACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177184
VPS13C MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 13 homolog C (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-2079s21c1
Sequence:CCGGCTCGGAAAGTTCTCGATTTAACTCGAGTTAAATCGAGAACTTTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177184.3-11323s21c1
Sequence:CCGGGGCCTGCTCAAGAGAACATTTCTCGAGAAATGTTCTCTTGAGCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-3734s21c1
Sequence:CCGGTTCCGTGTTTCTGTCGATATTCTCGAGAATATCGACAGAAACACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-9535s21c1
Sequence:CCGGCCCTATCCGGTGCCCTATTAACTCGAGTTAATAGGGCACCGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-8969s21c1
Sequence:CCGGTGGGATGTCCTCACGTATAAACTCGAGTTTATACGTGAGGACATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177184
VPS13C MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 13 homolog C (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-2079s21c1
Sequence:CCGGCTCGGAAAGTTCTCGATTTAACTCGAGTTAAATCGAGAACTTTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177184.3-11323s21c1
Sequence:CCGGGGCCTGCTCAAGAGAACATTTCTCGAGAAATGTTCTCTTGAGCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-3734s21c1
Sequence:CCGGTTCCGTGTTTCTGTCGATATTCTCGAGAATATCGACAGAAACACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-9535s21c1
Sequence:CCGGCCCTATCCGGTGCCCTATTAACTCGAGTTAATAGGGCACCGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-8969s21c1
Sequence:CCGGTGGGATGTCCTCACGTATAAACTCGAGTTTATACGTGAGGACATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177184
VPS13C MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 13 homolog C (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-2079s21c1
Sequence:CCGGCTCGGAAAGTTCTCGATTTAACTCGAGTTAAATCGAGAACTTTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177184.3-11323s21c1
Sequence:CCGGGGCCTGCTCAAGAGAACATTTCTCGAGAAATGTTCTCTTGAGCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-3734s21c1
Sequence:CCGGTTCCGTGTTTCTGTCGATATTCTCGAGAATATCGACAGAAACACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-9535s21c1
Sequence:CCGGCCCTATCCGGTGCCCTATTAACTCGAGTTAATAGGGCACCGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177184.3-8969s21c1
Sequence:CCGGTGGGATGTCCTCACGTATAAACTCGAGTTTATACGTGAGGACATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks