EMAIL THIS PAGE TO A FRIEND

VPS13D

vacuolar protein sorting 13 homolog D (S. cerevisiae)

Gene ID:
Human(55187) Summary: This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast, vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(230895) vacuolar protein sorting 13 D (yeast)
Rat(313825) vacuolar protein sorting 13 homolog D (S. cerevisiae)
Zebrafish(567879) vacuolar protein sorting 13D (yeast)
Horse(100050825) vacuolar protein sorting 13 homolog D (S. cerevisiae)
domestic cat(101101323) vacuolar protein sorting 13 homolog D (S. cerevisiae)
dog(478225) vacuolar protein sorting 13 homolog D (S. cerevisiae)
chicken(419481) vacuolar protein sorting 13 homolog D (S. cerevisiae)
cow(540683) vacuolar protein sorting 13 homolog D (S. cerevisiae)
sheep(101109724) vacuolar protein sorting 13 homolog D (S. cerevisiae)
naked mole-rat(101708864) vacuolar protein sorting 13 homolog D (S. cerevisiae)
Domestic Rabbit(100351863) vacuolar protein sorting 13 homolog D (S. cerevisiae)
domestic guinea pig(100722996) vacuolar protein sorting 13 homolog D (S. cerevisiae)
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001128198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001128198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015378 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015378 Rosetta Predictions human pricing
NM_018156 Rosetta Predictions human pricing
NM_001108006 Rosetta Predictions rat pricing
NM_001128198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155099 predicted 3025
2 SASI_Hs02_00347726 predicted 4274
3 SASI_Hs01_00155101 predicted 3947
4 SASI_Hs01_00155103 predicted 13001
5 SASI_Hs01_00155104 predicted 2917
6 SASI_Hs01_00155105 predicted 9735
7 SASI_Hs01_00155106 predicted 9119
8 SASI_Hs01_00155107 predicted 12558
9 SASI_Hs02_00347727 predicted 3746
10 SASI_Hs01_00155108 predicted 747
11 SASI_Hs01_00155100 predicted 3820
12 SASI_Hs01_00155102 predicted 8034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224646 predicted 3025
2 SASI_Hs02_00351397 predicted 4271
3 SASI_Hs01_00224648 predicted 3950
4 SASI_Hs01_00224650 predicted 12926
5 SASI_Hs01_00224651 predicted 2912
6 SASI_Hs01_00224652 predicted 9665
7 SASI_Hs01_00224653 predicted 9046
8 SASI_Hs01_00224654 predicted 12478
9 SASI_Hs02_00351398 predicted 3745
10 SASI_Hs01_00224655 predicted 750
11 SASI_Hs01_00224647 predicted 3819
12 SASI_Hs01_00224649 predicted 8041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234435 predicted 4500
2 SASI_Rn02_00234436 predicted 11800
3 SASI_Rn02_00234437 predicted 8123
4 SASI_Rn02_00234438 predicted 7532
5 SASI_Rn02_00234439 predicted 3386
6 SASI_Rn02_00234440 predicted 10692
7 SASI_Rn02_00234441 predicted 8386
8 SASI_Rn02_00234442 predicted 4622
9 SASI_Rn02_00234443 predicted 2113
10 SASI_Rn02_00234444 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310638 predicted 7469
2 SASI_Mm02_00310639 predicted 1137
3 SASI_Mm02_00310640 predicted 5290
4 SASI_Mm02_00310641 predicted 7889
5 SASI_Mm02_00310642 predicted 2773
6 SASI_Mm02_00310643 predicted 10405
7 SASI_Mm02_00310644 predicted 5379
8 SASI_Mm02_00310645 predicted 1889
9 SASI_Mm02_00310646 predicted 11232
10 SASI_Mm02_00310647 predicted 11561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128198
VALIDATED
VPS13D MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 13 homolog D (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128198.1-3726s21c1
Sequence:CCGGCGTCAGCGACATTGGCTATTTCTCGAGAAATAGCCAATGTCGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128198.1-416s21c1
Sequence:CCGGTCGTGGAGAATATCGAGTTAACTCGAGTTAACTCGATATTCTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128198.1-8235s21c1
Sequence:CCGGCACACTTTCTGGAGATTATTACTCGAGTAATAATCTCCAGAAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128198.1-1894s21c1
Sequence:CCGGTACAACCCACAGGCTATTAAACTCGAGTTTAATAGCCTGTGGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128198.1-3686s21c1
Sequence:CCGGATGTCGTCAGCATCGGAAATTCTCGAGAATTTCCGATGCTGACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128198
VALIDATED
VPS13D MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 13 homolog D (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128198.1-3726s21c1
Sequence:CCGGCGTCAGCGACATTGGCTATTTCTCGAGAAATAGCCAATGTCGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128198.1-416s21c1
Sequence:CCGGTCGTGGAGAATATCGAGTTAACTCGAGTTAACTCGATATTCTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128198.1-8235s21c1
Sequence:CCGGCACACTTTCTGGAGATTATTACTCGAGTAATAATCTCCAGAAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128198.1-1894s21c1
Sequence:CCGGTACAACCCACAGGCTATTAAACTCGAGTTTAATAGCCTGTGGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128198.1-3686s21c1
Sequence:CCGGATGTCGTCAGCATCGGAAATTCTCGAGAATTTCCGATGCTGACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128198
VALIDATED
VPS13D MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 13 homolog D (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128198.1-3726s21c1
Sequence:CCGGCGTCAGCGACATTGGCTATTTCTCGAGAAATAGCCAATGTCGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128198.1-416s21c1
Sequence:CCGGTCGTGGAGAATATCGAGTTAACTCGAGTTAACTCGATATTCTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128198.1-8235s21c1
Sequence:CCGGCACACTTTCTGGAGATTATTACTCGAGTAATAATCTCCAGAAAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128198.1-1894s21c1
Sequence:CCGGTACAACCCACAGGCTATTAAACTCGAGTTTAATAGCCTGTGGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001128198.1-3686s21c1
Sequence:CCGGATGTCGTCAGCATCGGAAATTCTCGAGAATTTCCGATGCTGACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015378
VALIDATED
VPS13D MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 13 homolog D (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-2050s21c1
Sequence:CCGGTACAATCCGCAGGCCATTAAACTCGAGTTTAATGGCCTGCGGATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-8391s21c1
Sequence:CCGGCACCCTTTCTGGAGATTATTACTCGAGTAATAATCTCCAGAAAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015378.2-13482s21c1
Sequence:CCGGTTGTGAGGCAGGGAGTTATTTCTCGAGAAATAACTCCCTGCCTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-10421s21c1
Sequence:CCGGCCAATCCCGAAGGTTACATTTCTCGAGAAATGTAACCTTCGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-3363s21c1
Sequence:CCGGAGAGCAAGAGTCCCTTATTAACTCGAGTTAATAAGGGACTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-6235s1c1
Sequence:CCGGCCCAGAAAGTTCCAGATCAAACTCGAGTTTGATCTGGAACTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-1577s1c1
Sequence:CCGGGCCTCGTGTATGAACACGTATCTCGAGATACGTGTTCATACACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-12194s1c1
Sequence:CCGGCGGTTTGAAGACGCTGTGATTCTCGAGAATCACAGCGTCTTCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-7061s1c1
Sequence:CCGGGCCAGATTTGACTTCAAGAAACTCGAGTTTCTTGAAGTCAAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-2024s1c1
Sequence:CCGGCCCTTGAACATCATATACAATCTCGAGATTGTATATGATGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015378
VALIDATED
VPS13D MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 13 homolog D (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-2050s21c1
Sequence:CCGGTACAATCCGCAGGCCATTAAACTCGAGTTTAATGGCCTGCGGATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-8391s21c1
Sequence:CCGGCACCCTTTCTGGAGATTATTACTCGAGTAATAATCTCCAGAAAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015378.2-13482s21c1
Sequence:CCGGTTGTGAGGCAGGGAGTTATTTCTCGAGAAATAACTCCCTGCCTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-10421s21c1
Sequence:CCGGCCAATCCCGAAGGTTACATTTCTCGAGAAATGTAACCTTCGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-3363s21c1
Sequence:CCGGAGAGCAAGAGTCCCTTATTAACTCGAGTTAATAAGGGACTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-6235s1c1
Sequence:CCGGCCCAGAAAGTTCCAGATCAAACTCGAGTTTGATCTGGAACTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-1577s1c1
Sequence:CCGGGCCTCGTGTATGAACACGTATCTCGAGATACGTGTTCATACACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-12194s1c1
Sequence:CCGGCGGTTTGAAGACGCTGTGATTCTCGAGAATCACAGCGTCTTCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-7061s1c1
Sequence:CCGGGCCAGATTTGACTTCAAGAAACTCGAGTTTCTTGAAGTCAAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-2024s1c1
Sequence:CCGGCCCTTGAACATCATATACAATCTCGAGATTGTATATGATGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015378
VALIDATED
VPS13D MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 13 homolog D (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-2050s21c1
Sequence:CCGGTACAATCCGCAGGCCATTAAACTCGAGTTTAATGGCCTGCGGATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-8391s21c1
Sequence:CCGGCACCCTTTCTGGAGATTATTACTCGAGTAATAATCTCCAGAAAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015378.2-13482s21c1
Sequence:CCGGTTGTGAGGCAGGGAGTTATTTCTCGAGAAATAACTCCCTGCCTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-10421s21c1
Sequence:CCGGCCAATCCCGAAGGTTACATTTCTCGAGAAATGTAACCTTCGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015378.2-3363s21c1
Sequence:CCGGAGAGCAAGAGTCCCTTATTAACTCGAGTTAATAAGGGACTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-6235s1c1
Sequence:CCGGCCCAGAAAGTTCCAGATCAAACTCGAGTTTGATCTGGAACTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-1577s1c1
Sequence:CCGGGCCTCGTGTATGAACACGTATCTCGAGATACGTGTTCATACACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-12194s1c1
Sequence:CCGGCGGTTTGAAGACGCTGTGATTCTCGAGAATCACAGCGTCTTCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-7061s1c1
Sequence:CCGGGCCAGATTTGACTTCAAGAAACTCGAGTTTCTTGAAGTCAAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015378.1-2024s1c1
Sequence:CCGGCCCTTGAACATCATATACAATCTCGAGATTGTATATGATGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks