EMAIL THIS PAGE TO A FRIEND

VPS16

vacuolar protein sorting 16 homolog (S. cerevisiae)

Synonyms: hVPS16
Gene ID:
Human(64601) Summary: Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
Mouse(80743) vacuolar protein sorting 16 (yeast)
Rat(296159) vacuolar protein sorting 16 homolog (S. cerevisiae)
domestic guinea pig(100721004) vacuolar protein sorting 16 homolog (S. cerevisiae)
Domestic Rabbit(100354017) vacuolar protein sorting 16 homolog (S. cerevisiae)
naked mole-rat(101712558) vacuolar protein sorting 16 homolog (S. cerevisiae)
cow(505361) vacuolar protein sorting 16 homolog (S. cerevisiae)
sheep(101102580) vacuolar protein sorting 16 homolog (S. cerevisiae)
chicken(426571) vacuolar protein sorting 16 homolog (S. cerevisiae)
dog(607930) vacuolar protein sorting 16 homolog (S. cerevisiae)
domestic cat(101097716) vacuolar protein sorting 16 homolog (S. cerevisiae)
Gene Class: Cytoskeleton
181 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022575 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU052611 MISSION® esiRNA esiRNA targeting mouse Vps16 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022575 Rosetta Predictions human pricing
NM_080413 Rosetta Predictions human pricing
NM_080414 Rosetta Predictions human pricing
NM_001005541 Rosetta Predictions rat pricing
NM_030559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028345 predicted 2328
2 SASI_Hs01_00028346 predicted 2476
3 SASI_Hs02_00355878 predicted 2194
4 SASI_Hs01_00028347 predicted 2465
5 SASI_Hs01_00028348 predicted 2138
6 SASI_Hs01_00028350 predicted 1897
7 SASI_Hs01_00028351 predicted 2037
8 SASI_Hs01_00028352 predicted 2116
9 SASI_Hs01_00028353 predicted 2435
10 SASI_Hs02_00355879 predicted 2302
11 SASI_Hs01_00028349 predicted 2340
12 SASI_Hs01_00028354 predicted 2396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192194 predicted 1899
2 SASI_Hs01_00192195 predicted 2041
3 SASI_Hs02_00362246 predicted 1758
4 SASI_Hs01_00192196 predicted 2030
5 SASI_Hs01_00192197 predicted 1711
6 SASI_Hs01_00192199 predicted 1462
7 SASI_Hs01_00192200 predicted 1604
8 SASI_Hs01_00192201 predicted 1681
9 SASI_Hs01_00192202 predicted 2001
10 SASI_Hs02_00362247 predicted 1864
11 SASI_Hs01_00192198 predicted 1909
12 SASI_Hs01_00192203 predicted 1960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129516 predicted 907
2 SASI_Hs01_00129517 predicted 1049
3 SASI_Hs02_00362248 predicted 763
4 SASI_Hs01_00129518 predicted 1039
5 SASI_Hs01_00129519 predicted 715
6 SASI_Hs01_00129521 predicted 467
7 SASI_Hs01_00129522 predicted 606
8 SASI_Hs01_00129523 predicted 681
9 SASI_Hs01_00129524 predicted 1006
10 SASI_Hs02_00362249 predicted 876
11 SASI_Hs01_00129520 predicted 914
12 SASI_Hs01_00129525 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080125 predicted 1013
2 SASI_Rn02_00198396 predicted 909
3 SASI_Rn01_00080127 predicted 1932
4 SASI_Rn01_00080128 predicted 1839
5 SASI_Rn01_00080129 predicted 693
6 SASI_Rn01_00080130 predicted 2099
7 SASI_Rn01_00080131 predicted 2303
8 SASI_Rn01_00080132 predicted 1081
9 SASI_Rn01_00080133 predicted 402
10 SASI_Rn02_00198397 predicted 1895
11 SASI_Rn01_00080124 predicted 2097
12 SASI_Rn01_00080126 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094704 predicted 831
2 SASI_Mm01_00094705 predicted 1002
3 SASI_Mm01_00094706 predicted 1203
4 SASI_Mm01_00094707 predicted 2072
5 SASI_Mm02_00336765 predicted 1543
6 SASI_Mm01_00094708 predicted 679
7 SASI_Mm01_00094709 predicted 562
8 SASI_Mm01_00094711 predicted 1467
9 SASI_Mm02_00336766 predicted 1692
10 SASI_Mm01_00094712 predicted 1291
11 SASI_Mm01_00094703 predicted 372
12 SASI_Mm01_00094710 predicted 1486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022575
VPS16 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 16 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022575.2-2575s1c1
Sequence:CCGGCATCCTGTACATCTCAAGCAACTCGAGTTGCTTGAGATGTACAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-2407s1c1
Sequence:CCGGGCTTTGCTTCTTGTTGGCGATCTCGAGATCGCCAACAAGAAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-1045s1c1
Sequence:CCGGGCCAGCGAGGAAATCTTCAAACTCGAGTTTGAAGATTTCCTCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-448s1c1
Sequence:CCGGCGGATCTTTCACACTGAGTTTCTCGAGAAACTCAGTGTGAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-2246s1c1
Sequence:CCGGCCCTGGCAGATTTGGAAGATTCTCGAGAATCTTCCAAATCTGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-1365s21c1
Sequence:CCGGGCTCACCTATAGCCAATATAACTCGAGTTATATTGGCTATAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022575.2-2571s21c1
Sequence:CCGGAGTCCATCCTGTACATCTCAACTCGAGTTGAGATGTACAGGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-1416s21c1
Sequence:CCGGGCTCGTGTTGCGGAGACTTTACTCGAGTAAAGTCTCCGCAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-1331s21c1
Sequence:CCGGTCAATGCTGTTCGGGACTATCCTCGAGGATAGTCCCGAACAGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-233s21c1
Sequence:CCGGTGAGGCCAGTGCTCGATATATCTCGAGATATATCGAGCACTGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022575
VPS16 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 16 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022575.2-2575s1c1
Sequence:CCGGCATCCTGTACATCTCAAGCAACTCGAGTTGCTTGAGATGTACAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-2407s1c1
Sequence:CCGGGCTTTGCTTCTTGTTGGCGATCTCGAGATCGCCAACAAGAAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-1045s1c1
Sequence:CCGGGCCAGCGAGGAAATCTTCAAACTCGAGTTTGAAGATTTCCTCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-448s1c1
Sequence:CCGGCGGATCTTTCACACTGAGTTTCTCGAGAAACTCAGTGTGAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-2246s1c1
Sequence:CCGGCCCTGGCAGATTTGGAAGATTCTCGAGAATCTTCCAAATCTGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-1365s21c1
Sequence:CCGGGCTCACCTATAGCCAATATAACTCGAGTTATATTGGCTATAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022575.2-2571s21c1
Sequence:CCGGAGTCCATCCTGTACATCTCAACTCGAGTTGAGATGTACAGGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-1416s21c1
Sequence:CCGGGCTCGTGTTGCGGAGACTTTACTCGAGTAAAGTCTCCGCAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-1331s21c1
Sequence:CCGGTCAATGCTGTTCGGGACTATCCTCGAGGATAGTCCCGAACAGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-233s21c1
Sequence:CCGGTGAGGCCAGTGCTCGATATATCTCGAGATATATCGAGCACTGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022575
VPS16 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 16 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022575.2-2575s1c1
Sequence:CCGGCATCCTGTACATCTCAAGCAACTCGAGTTGCTTGAGATGTACAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-2407s1c1
Sequence:CCGGGCTTTGCTTCTTGTTGGCGATCTCGAGATCGCCAACAAGAAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-1045s1c1
Sequence:CCGGGCCAGCGAGGAAATCTTCAAACTCGAGTTTGAAGATTTCCTCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-448s1c1
Sequence:CCGGCGGATCTTTCACACTGAGTTTCTCGAGAAACTCAGTGTGAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022575.2-2246s1c1
Sequence:CCGGCCCTGGCAGATTTGGAAGATTCTCGAGAATCTTCCAAATCTGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-1365s21c1
Sequence:CCGGGCTCACCTATAGCCAATATAACTCGAGTTATATTGGCTATAGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022575.2-2571s21c1
Sequence:CCGGAGTCCATCCTGTACATCTCAACTCGAGTTGAGATGTACAGGATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-1416s21c1
Sequence:CCGGGCTCGTGTTGCGGAGACTTTACTCGAGTAAAGTCTCCGCAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-1331s21c1
Sequence:CCGGTCAATGCTGTTCGGGACTATCCTCGAGGATAGTCCCGAACAGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022575.2-233s21c1
Sequence:CCGGTGAGGCCAGTGCTCGATATATCTCGAGATATATCGAGCACTGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030559
VALIDATED
VPS16 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 16 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-914s21c1
Sequence:CCGGTCGATGAGGACTCCTACTTAGCTCGAGCTAAGTAGGAGTCCTCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-1919s21c1
Sequence:CCGGATGCCGCTGAAGAGCGTATTGCTCGAGCAATACGCTCTTCAGCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-313s21c1
Sequence:CCGGGATGGTGCAGTGCTAGTTTATCTCGAGATAAACTAGCACTGCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-585s21c1
Sequence:CCGGGGCTGTAGGACCCGATCTTTACTCGAGTAAAGATCGGGTCCTACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030559.2-1509s21c1
Sequence:CCGGAGATGTAGCACGGGCTATTAACTCGAGTTAATAGCCCGTGCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030559
VALIDATED
VPS16 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 16 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-914s21c1
Sequence:CCGGTCGATGAGGACTCCTACTTAGCTCGAGCTAAGTAGGAGTCCTCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-1919s21c1
Sequence:CCGGATGCCGCTGAAGAGCGTATTGCTCGAGCAATACGCTCTTCAGCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-313s21c1
Sequence:CCGGGATGGTGCAGTGCTAGTTTATCTCGAGATAAACTAGCACTGCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-585s21c1
Sequence:CCGGGGCTGTAGGACCCGATCTTTACTCGAGTAAAGATCGGGTCCTACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030559.2-1509s21c1
Sequence:CCGGAGATGTAGCACGGGCTATTAACTCGAGTTAATAGCCCGTGCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030559
VALIDATED
VPS16 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 16 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-914s21c1
Sequence:CCGGTCGATGAGGACTCCTACTTAGCTCGAGCTAAGTAGGAGTCCTCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-1919s21c1
Sequence:CCGGATGCCGCTGAAGAGCGTATTGCTCGAGCAATACGCTCTTCAGCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-313s21c1
Sequence:CCGGGATGGTGCAGTGCTAGTTTATCTCGAGATAAACTAGCACTGCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030559.2-585s21c1
Sequence:CCGGGGCTGTAGGACCCGATCTTTACTCGAGTAAAGATCGGGTCCTACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030559.2-1509s21c1
Sequence:CCGGAGATGTAGCACGGGCTATTAACTCGAGTTAATAGCCCGTGCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks