EMAIL THIS PAGE TO A FRIEND

VPS18

vacuolar protein sorting 18 homolog (S. cerevisiae)

Synonyms: PEP3
UniProtKB ID: Q9P253, Q8TCG0, Q96DI3, Q9H268
Gene ID:
Human(57617) Summary: Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps18 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
Mouse(228545) vacuolar protein sorting 18 (yeast)
Rat(296083) vacuolar protein sorting 18 homolog (S. cerevisiae)
Zebrafish(100005887) vacuolar protein sorting protein 18
chicken(423207) vacuolar protein sorting 18 homolog (S. cerevisiae)
dog(487503) vacuolar protein sorting 18 homolog (S. cerevisiae)
domestic cat(101087236) vacuolar protein sorting 18 homolog (S. cerevisiae)
Horse(100057119) vacuolar protein sorting 18 homolog (S. cerevisiae)
cow(518781) vacuolar protein sorting 18 homolog (S. cerevisiae)
sheep(101111552) vacuolar protein sorting 18 homolog (S. cerevisiae)
Goat(100861321) vacuolar protein sorting 18 homolog (S. cerevisiae)
naked mole-rat(101720951) vacuolar protein sorting 18 homolog (S. cerevisiae)
Domestic Rabbit(100353953) vacuolar protein sorting 18 homolog (S. cerevisiae)
domestic guinea pig(100718516) vacuolar protein sorting 18 homolog (S. cerevisiae)
Gene Class: Cytoskeleton
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020857 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010591 MISSION® esiRNA esiRNA targeting human VPS18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020857 Rosetta Predictions human pricing
NM_001106499 Rosetta Predictions rat pricing
NM_172269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055981 predicted 616
2 SASI_Hs01_00055982 predicted 472
3 SASI_Hs02_00354123 predicted 505
4 SASI_Hs01_00055983 predicted 2008
5 SASI_Hs01_00055984 predicted 572
6 SASI_Hs01_00055986 predicted 910
7 SASI_Hs01_00055987 predicted 718
8 SASI_Hs01_00055988 predicted 2417
9 SASI_Hs01_00055989 predicted 1518
10 SASI_Hs02_00354124 predicted 1990
11 SASI_Hs01_00055980 predicted 1777
12 SASI_Hs01_00055985 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219568 predicted 1418
2 SASI_Rn02_00219569 predicted 413
3 SASI_Rn02_00219570 predicted 2646
4 SASI_Rn02_00219571 predicted 2684
5 SASI_Rn02_00219572 predicted 2627
6 SASI_Rn02_00219573 predicted 1191
7 SASI_Rn02_00219574 predicted 816
8 SASI_Rn02_00219575 predicted 1541
9 SASI_Rn02_00219576 predicted 1232
10 SASI_Rn02_00219577 predicted 2660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071234 predicted 2699
2 SASI_Mm01_00071235 predicted 843
3 SASI_Mm01_00071236 predicted 1637
4 SASI_Mm01_00071237 predicted 1685
5 SASI_Mm01_00071238 predicted 719
6 SASI_Mm01_00071239 predicted 1531
7 SASI_Mm02_00343748 predicted 1957
8 SASI_Mm01_00071240 predicted 2678
9 SASI_Mm01_00071241 predicted 604
10 SASI_Mm01_00071242 predicted 1968
11 SASI_Mm01_00071233 predicted 1057
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020857
VPS18 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 18 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-3184s21c1
Sequence:GTACCGGGAGCTGATGATCCGCTCTATCCTCGAGGATAGAGCGGATCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-575s21c1
Sequence:GTACCGGTTGACTTGGGCAAGGCAAATGCTCGAGCATTTGCCTTGCCCAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-2696s21c1
Sequence:GTACCGGAGGATGTGCTGCCCTTCTTTCCTCGAGGAAAGAAGGGCAGCACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-1688s21c1
Sequence:GTACCGGAGAGCTACTTTGAGGAGATTGCTCGAGCAATCTCCTCAAAGTAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-700s21c1
Sequence:GTACCGGGTCCTCTACGTGAACCGAAATCTCGAGATTTCGGTTCACGTAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020857.2-3411s21c1
Sequence:GTACCGGGGTGTCAGGTGTGAGTGTATTCTCGAGAATACACTCACACCTGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-1406s21c1
Sequence:GTACCGGGGGATCACTTCCTGGAGAAATCTCGAGATTTCTCCAGGAAGTGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-2748s21c1
Sequence:GTACCGGGGCGATCTGCAGCTCACTTAACTCGAGTTAAGTGAGCTGCAGATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020857.2-3504s1c1
Sequence:CCGGCTTCACCTGGAGAAGTCAGAACTCGAGTTCTGACTTCTCCAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020857.2-708s1c1
Sequence:CCGGCGTGAACCGAAATGGACAGAACTCGAGTTCTGTCCATTTCGGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020857.2-1882s1c1
Sequence:CCGGCTCTACCGAGAAACCAAGGAACTCGAGTTCCTTGGTTTCTCGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020857.2-465s1c1
Sequence:CCGGCATCTTCACAAAGCAGCGCATCTCGAGATGCGCTGCTTTGTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020857
VPS18 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 18 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-3184s21c1
Sequence:GTACCGGGAGCTGATGATCCGCTCTATCCTCGAGGATAGAGCGGATCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-575s21c1
Sequence:GTACCGGTTGACTTGGGCAAGGCAAATGCTCGAGCATTTGCCTTGCCCAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-2696s21c1
Sequence:GTACCGGAGGATGTGCTGCCCTTCTTTCCTCGAGGAAAGAAGGGCAGCACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-1688s21c1
Sequence:GTACCGGAGAGCTACTTTGAGGAGATTGCTCGAGCAATCTCCTCAAAGTAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-700s21c1
Sequence:GTACCGGGTCCTCTACGTGAACCGAAATCTCGAGATTTCGGTTCACGTAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020857.2-3411s21c1
Sequence:GTACCGGGGTGTCAGGTGTGAGTGTATTCTCGAGAATACACTCACACCTGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-1406s21c1
Sequence:GTACCGGGGGATCACTTCCTGGAGAAATCTCGAGATTTCTCCAGGAAGTGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-2748s21c1
Sequence:GTACCGGGGCGATCTGCAGCTCACTTAACTCGAGTTAAGTGAGCTGCAGATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020857.2-3504s1c1
Sequence:CCGGCTTCACCTGGAGAAGTCAGAACTCGAGTTCTGACTTCTCCAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020857.2-708s1c1
Sequence:CCGGCGTGAACCGAAATGGACAGAACTCGAGTTCTGTCCATTTCGGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020857.2-1882s1c1
Sequence:CCGGCTCTACCGAGAAACCAAGGAACTCGAGTTCCTTGGTTTCTCGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020857.2-465s1c1
Sequence:CCGGCATCTTCACAAAGCAGCGCATCTCGAGATGCGCTGCTTTGTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020857
VPS18 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 18 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-3184s21c1
Sequence:GTACCGGGAGCTGATGATCCGCTCTATCCTCGAGGATAGAGCGGATCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-575s21c1
Sequence:GTACCGGTTGACTTGGGCAAGGCAAATGCTCGAGCATTTGCCTTGCCCAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-2696s21c1
Sequence:GTACCGGAGGATGTGCTGCCCTTCTTTCCTCGAGGAAAGAAGGGCAGCACATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-1688s21c1
Sequence:GTACCGGAGAGCTACTTTGAGGAGATTGCTCGAGCAATCTCCTCAAAGTAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-700s21c1
Sequence:GTACCGGGTCCTCTACGTGAACCGAAATCTCGAGATTTCGGTTCACGTAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020857.2-3411s21c1
Sequence:GTACCGGGGTGTCAGGTGTGAGTGTATTCTCGAGAATACACTCACACCTGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-1406s21c1
Sequence:GTACCGGGGGATCACTTCCTGGAGAAATCTCGAGATTTCTCCAGGAAGTGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020857.2-2748s21c1
Sequence:GTACCGGGGCGATCTGCAGCTCACTTAACTCGAGTTAAGTGAGCTGCAGATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020857.2-3504s1c1
Sequence:CCGGCTTCACCTGGAGAAGTCAGAACTCGAGTTCTGACTTCTCCAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020857.2-708s1c1
Sequence:CCGGCGTGAACCGAAATGGACAGAACTCGAGTTCTGTCCATTTCGGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020857.2-1882s1c1
Sequence:CCGGCTCTACCGAGAAACCAAGGAACTCGAGTTCCTTGGTTTCTCGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020857.2-465s1c1
Sequence:CCGGCATCTTCACAAAGCAGCGCATCTCGAGATGCGCTGCTTTGTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172269
VPS18 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 18 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172269.3-1072s21c1
Sequence:CCGGCCGTGAGTTTCCTAGCAATTTCTCGAGAAATTGCTAGGAAACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172269.3-2448s21c1
Sequence:CCGGATAAGGTGTTGGAGCTATATGCTCGAGCATATAGCTCCAACACCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172269.3-646s21c1
Sequence:CCGGGAGTAGCACCGAGGTCCTTTACTCGAGTAAAGGACCTCGGTGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172269.2-3852s1c1
Sequence:CCGGGCCAGCCTAGTCGACATAATACTCGAGTATTATGTCGACTAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-857s1c1
Sequence:CCGGCCACTGTATGTGTTAAATGAACTCGAGTTCATTTAACACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-2356s1c1
Sequence:CCGGCCGTGTACATTATGATCTCAACTCGAGTTGAGATCATAATGTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-644s1c1
Sequence:CCGGGTCCTTTACATGAACCGCAATCTCGAGATTGCGGTTCATGTAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-1961s1c1
Sequence:CCGGGCAGTGATCATGCAGGACTATCTCGAGATAGTCCTGCATGATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172269
VPS18 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 18 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172269.3-1072s21c1
Sequence:CCGGCCGTGAGTTTCCTAGCAATTTCTCGAGAAATTGCTAGGAAACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172269.3-2448s21c1
Sequence:CCGGATAAGGTGTTGGAGCTATATGCTCGAGCATATAGCTCCAACACCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172269.3-646s21c1
Sequence:CCGGGAGTAGCACCGAGGTCCTTTACTCGAGTAAAGGACCTCGGTGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172269.2-3852s1c1
Sequence:CCGGGCCAGCCTAGTCGACATAATACTCGAGTATTATGTCGACTAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-857s1c1
Sequence:CCGGCCACTGTATGTGTTAAATGAACTCGAGTTCATTTAACACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-2356s1c1
Sequence:CCGGCCGTGTACATTATGATCTCAACTCGAGTTGAGATCATAATGTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-644s1c1
Sequence:CCGGGTCCTTTACATGAACCGCAATCTCGAGATTGCGGTTCATGTAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-1961s1c1
Sequence:CCGGGCAGTGATCATGCAGGACTATCTCGAGATAGTCCTGCATGATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172269
VPS18 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 18 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172269.3-1072s21c1
Sequence:CCGGCCGTGAGTTTCCTAGCAATTTCTCGAGAAATTGCTAGGAAACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172269.3-2448s21c1
Sequence:CCGGATAAGGTGTTGGAGCTATATGCTCGAGCATATAGCTCCAACACCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172269.3-646s21c1
Sequence:CCGGGAGTAGCACCGAGGTCCTTTACTCGAGTAAAGGACCTCGGTGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172269.2-3852s1c1
Sequence:CCGGGCCAGCCTAGTCGACATAATACTCGAGTATTATGTCGACTAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-857s1c1
Sequence:CCGGCCACTGTATGTGTTAAATGAACTCGAGTTCATTTAACACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-2356s1c1
Sequence:CCGGCCGTGTACATTATGATCTCAACTCGAGTTGAGATCATAATGTACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-644s1c1
Sequence:CCGGGTCCTTTACATGAACCGCAATCTCGAGATTGCGGTTCATGTAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172269.2-1961s1c1
Sequence:CCGGGCAGTGATCATGCAGGACTATCTCGAGATAGTCCTGCATGATCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks