EMAIL THIS PAGE TO A FRIEND

VPS25

vacuolar protein sorting 25 homolog (S. cerevisiae)

Synonyms: DERP9 EAP20 FAP20
UniProtKB ID: Q9BRG1, B2R581
Gene ID:
Human(84313) Summary: VPS25, VPS36 (MIM 610903), and SNF8 (MIM 610904) form ESCRT-II (endosomal sorting complex required for transport II), a complex involved in endocytosis of ubiquitinated membrane proteins. VPS25, VPS36, and SNF8 are also associated in a multiprotein complex with RNA polymerase II elongation factor (ELL; MIM 600284) (Slagsvold et al., 2005 [PubMed 15755741]
Mouse(28084) vacuolar protein sorting 25 (yeast)
Rat(681059) vacuolar protein sorting 25 homolog (S. cerevisiae)
fruit fly(35847) Vacuolar protein sorting 25
Thale Cress(827637) vacuolar protein sorting-associated protein 25
domestic cat(101100014) vacuolar protein sorting 25 homolog (S. cerevisiae)
dog(612774) vacuolar protein sorting 25 homolog (S. cerevisiae)
chicken(420021) vacuolar protein sorting 25 homolog (S. cerevisiae)
Zebrafish(407684) vacuolar protein sorting 25 (yeast)
domestic guinea pig(100720959) vacuolar protein sorting 25 homolog (S. cerevisiae)
naked mole-rat(101713179) vacuolar protein sorting 25 homolog (S. cerevisiae)
cow(534750) vacuolar protein sorting 25 homolog (S. cerevisiae)
sheep(101105424) vacuolar protein sorting 25 homolog (S. cerevisiae)
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032353 Rosetta Predictions human pricing
XM_001060127 Rosetta Predictions rat pricing
NM_026776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149514 predicted 573
2 SASI_Hs01_00149515 predicted 290
3 SASI_Hs01_00149516 predicted 314
4 SASI_Hs01_00149517 predicted 248
5 SASI_Hs01_00149518 predicted 415
6 SASI_Hs01_00149519 predicted 394
7 SASI_Hs01_00149520 predicted 820
8 SASI_Hs01_00149521 predicted 225
9 SASI_Hs01_00149522 predicted 207
10 SASI_Hs01_00149523 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295457 predicted 1209
2 SASI_Rn02_00295458 predicted 1069
3 SASI_Rn02_00295459 predicted 302
4 SASI_Rn02_00295460 predicted 1337
5 SASI_Rn02_00295461 predicted 1066
6 SASI_Rn02_00295462 predicted 764
7 SASI_Rn02_00295463 predicted 918
8 SASI_Rn02_00295464 predicted 1334
9 SASI_Rn02_00295465 predicted 739
10 SASI_Rn02_00295466 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330851 predicted 210
2 SASI_Mm01_00042560 predicted 261
3 SASI_Mm01_00042561 predicted 260
4 SASI_Mm01_00042563 predicted 666
5 SASI_Mm01_00042564 predicted 370
6 SASI_Mm02_00330852 predicted 209
7 SASI_Mm02_00330853 predicted 801
8 SASI_Mm01_00042567 predicted 527
9 SASI_Mm01_00042568 predicted 220
10 SASI_Mm01_00042569 predicted 331
11 SASI_Mm01_00042562 predicted 651
12 SASI_Mm01_00042565 predicted 378
13 SASI_Mm01_00042566 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032353
VALIDATED
VPS25 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 25 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032353.2-254s1c1
Sequence:CCGGGAGTCGATCCAGATTGTATTACTCGAGTAATACAATCTGGATCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032353.2-85s1c1
Sequence:CCGGCTTCTTTACGTTACAACCGAACTCGAGTTCGGTTGTAACGTAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032353.2-527s1c1
Sequence:CCGGGAGATCATCACTGTCAGCGATCTCGAGATCGCTGACAGTGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032353.2-578s1c1
Sequence:CCGGCCTGTCTCCCTTTACTTCTTACTCGAGTAAGAAGTAAAGGGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032353.2-585s1c1
Sequence:CCGGCCCTTTACTTCTTACCTCCCACTCGAGTGGGAGGTAAGAAGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032353.2-251s1c1
Sequence:CCGGGTGGAGTCGATCCAGATTGTACTCGAGTACAATCTGGATCGACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032353.2-214s1c1
Sequence:CCGGGCTCTTCAACAACGTCAAGCTCTCGAGAGCTTGACGTTGTTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032353.2-730s1c1
Sequence:CCGGCATATGTCTGTCCCTTGGATACTCGAGTATCCAAGGGACAGACATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-321s21c1
Sequence:GTACCGGAGTCCAGCTTCCTGATCATGTCTCGAGACATGATCAGGAAGCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032353.2-585s21c1
Sequence:CCGGCCCTTTACTTCTTACCTCCCACTCGAGTGGGAGGTAAGAAGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-72s21c1
Sequence:CCGGATCGCTTCCCACCCTTCTTTACTCGAGTAAAGAAGGGTGGGAAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-255s21c1
Sequence:CCGGAGTCGATCCAGATTGTATTAGCTCGAGCTAATACAATCTGGATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032353.2-730s21c1
Sequence:CCGGCATATGTCTGTCCCTTGGATACTCGAGTATCCAAGGGACAGACATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032353.2-396s21c1
Sequence:CCGGGCCAGAACAACTCCGTCTTTACTCGAGTAAAGACGGAGTTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-516s21c1
Sequence:GTACCGGAGCACAAGGCCGAGATCATCACTCGAGTGATGATCTCGGCCTTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032353
VALIDATED
VPS25 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 25 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032353.2-254s1c1
Sequence:CCGGGAGTCGATCCAGATTGTATTACTCGAGTAATACAATCTGGATCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032353.2-85s1c1
Sequence:CCGGCTTCTTTACGTTACAACCGAACTCGAGTTCGGTTGTAACGTAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032353.2-527s1c1
Sequence:CCGGGAGATCATCACTGTCAGCGATCTCGAGATCGCTGACAGTGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032353.2-578s1c1
Sequence:CCGGCCTGTCTCCCTTTACTTCTTACTCGAGTAAGAAGTAAAGGGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032353.2-585s1c1
Sequence:CCGGCCCTTTACTTCTTACCTCCCACTCGAGTGGGAGGTAAGAAGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032353.2-251s1c1
Sequence:CCGGGTGGAGTCGATCCAGATTGTACTCGAGTACAATCTGGATCGACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032353.2-214s1c1
Sequence:CCGGGCTCTTCAACAACGTCAAGCTCTCGAGAGCTTGACGTTGTTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032353.2-730s1c1
Sequence:CCGGCATATGTCTGTCCCTTGGATACTCGAGTATCCAAGGGACAGACATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-321s21c1
Sequence:GTACCGGAGTCCAGCTTCCTGATCATGTCTCGAGACATGATCAGGAAGCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032353.2-585s21c1
Sequence:CCGGCCCTTTACTTCTTACCTCCCACTCGAGTGGGAGGTAAGAAGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-72s21c1
Sequence:CCGGATCGCTTCCCACCCTTCTTTACTCGAGTAAAGAAGGGTGGGAAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-255s21c1
Sequence:CCGGAGTCGATCCAGATTGTATTAGCTCGAGCTAATACAATCTGGATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032353.2-730s21c1
Sequence:CCGGCATATGTCTGTCCCTTGGATACTCGAGTATCCAAGGGACAGACATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032353.2-396s21c1
Sequence:CCGGGCCAGAACAACTCCGTCTTTACTCGAGTAAAGACGGAGTTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-516s21c1
Sequence:GTACCGGAGCACAAGGCCGAGATCATCACTCGAGTGATGATCTCGGCCTTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032353
VALIDATED
VPS25 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 25 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032353.2-254s1c1
Sequence:CCGGGAGTCGATCCAGATTGTATTACTCGAGTAATACAATCTGGATCGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032353.2-85s1c1
Sequence:CCGGCTTCTTTACGTTACAACCGAACTCGAGTTCGGTTGTAACGTAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032353.2-527s1c1
Sequence:CCGGGAGATCATCACTGTCAGCGATCTCGAGATCGCTGACAGTGATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032353.2-578s1c1
Sequence:CCGGCCTGTCTCCCTTTACTTCTTACTCGAGTAAGAAGTAAAGGGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032353.2-585s1c1
Sequence:CCGGCCCTTTACTTCTTACCTCCCACTCGAGTGGGAGGTAAGAAGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032353.2-251s1c1
Sequence:CCGGGTGGAGTCGATCCAGATTGTACTCGAGTACAATCTGGATCGACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032353.2-214s1c1
Sequence:CCGGGCTCTTCAACAACGTCAAGCTCTCGAGAGCTTGACGTTGTTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032353.2-730s1c1
Sequence:CCGGCATATGTCTGTCCCTTGGATACTCGAGTATCCAAGGGACAGACATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-321s21c1
Sequence:GTACCGGAGTCCAGCTTCCTGATCATGTCTCGAGACATGATCAGGAAGCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032353.2-585s21c1
Sequence:CCGGCCCTTTACTTCTTACCTCCCACTCGAGTGGGAGGTAAGAAGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-72s21c1
Sequence:CCGGATCGCTTCCCACCCTTCTTTACTCGAGTAAAGAAGGGTGGGAAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-255s21c1
Sequence:CCGGAGTCGATCCAGATTGTATTAGCTCGAGCTAATACAATCTGGATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032353.2-730s21c1
Sequence:CCGGCATATGTCTGTCCCTTGGATACTCGAGTATCCAAGGGACAGACATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032353.2-396s21c1
Sequence:CCGGGCCAGAACAACTCCGTCTTTACTCGAGTAAAGACGGAGTTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032353.2-516s21c1
Sequence:GTACCGGAGCACAAGGCCGAGATCATCACTCGAGTGATGATCTCGGCCTTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026776
VALIDATED
VPS25 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 25 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026776.3-336s1c1
Sequence:CCGGGAAACTCATTTACCAATGGGTCTCGAGACCCATTGGTAAATGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026776.3-684s1c1
Sequence:CCGGGTTTCCCACATAACCCTTTATCTCGAGATAAAGGGTTATGTGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026776.3-368s1c1
Sequence:CCGGGCCAGAATAACTCTGTGTTTACTCGAGTAAACACAGAGTTATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026776.3-675s1c1
Sequence:CCGGCTTAGGGATGTTTCCCACATACTCGAGTATGTGGGAAACATCCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026776.3-57s1c1
Sequence:CCGGCTTCTTTACGTTACAGCCGAACTCGAGTTCGGCTGTAACGTAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-294s21c1
Sequence:GTACCGGGTCTAGCTTCCTGATCATGTGCTCGAGCACATGATCAGGAAGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-197s21c1
Sequence:GTACCGGACGTCAAGCTACAGCGGAAACCTCGAGGTTTCCGCTGTAGCTTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-491s21c1
Sequence:GTACCGGACAAGGCTGAGATTATCACTGCTCGAGCAGTGATAATCTCAGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-339s21c1
Sequence:GTACCGGACTCATTTACCAATGGGTTTCCTCGAGGAAACCCATTGGTAAATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026776
VALIDATED
VPS25 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 25 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026776.3-336s1c1
Sequence:CCGGGAAACTCATTTACCAATGGGTCTCGAGACCCATTGGTAAATGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026776.3-684s1c1
Sequence:CCGGGTTTCCCACATAACCCTTTATCTCGAGATAAAGGGTTATGTGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026776.3-368s1c1
Sequence:CCGGGCCAGAATAACTCTGTGTTTACTCGAGTAAACACAGAGTTATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026776.3-675s1c1
Sequence:CCGGCTTAGGGATGTTTCCCACATACTCGAGTATGTGGGAAACATCCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026776.3-57s1c1
Sequence:CCGGCTTCTTTACGTTACAGCCGAACTCGAGTTCGGCTGTAACGTAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-294s21c1
Sequence:GTACCGGGTCTAGCTTCCTGATCATGTGCTCGAGCACATGATCAGGAAGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-197s21c1
Sequence:GTACCGGACGTCAAGCTACAGCGGAAACCTCGAGGTTTCCGCTGTAGCTTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-491s21c1
Sequence:GTACCGGACAAGGCTGAGATTATCACTGCTCGAGCAGTGATAATCTCAGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-339s21c1
Sequence:GTACCGGACTCATTTACCAATGGGTTTCCTCGAGGAAACCCATTGGTAAATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026776
VALIDATED
VPS25 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 25 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026776.3-336s1c1
Sequence:CCGGGAAACTCATTTACCAATGGGTCTCGAGACCCATTGGTAAATGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026776.3-684s1c1
Sequence:CCGGGTTTCCCACATAACCCTTTATCTCGAGATAAAGGGTTATGTGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026776.3-368s1c1
Sequence:CCGGGCCAGAATAACTCTGTGTTTACTCGAGTAAACACAGAGTTATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_026776.3-675s1c1
Sequence:CCGGCTTAGGGATGTTTCCCACATACTCGAGTATGTGGGAAACATCCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026776.3-57s1c1
Sequence:CCGGCTTCTTTACGTTACAGCCGAACTCGAGTTCGGCTGTAACGTAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-294s21c1
Sequence:GTACCGGGTCTAGCTTCCTGATCATGTGCTCGAGCACATGATCAGGAAGCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-197s21c1
Sequence:GTACCGGACGTCAAGCTACAGCGGAAACCTCGAGGTTTCCGCTGTAGCTTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-491s21c1
Sequence:GTACCGGACAAGGCTGAGATTATCACTGCTCGAGCAGTGATAATCTCAGCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026776.3-339s21c1
Sequence:GTACCGGACTCATTTACCAATGGGTTTCCTCGAGGAAACCCATTGGTAAATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks