EMAIL THIS PAGE TO A FRIEND

VPS26A

vacuolar protein sorting 26 homolog A (S. pombe)

Synonyms: HB58 Hbeta58 PEP8A VPS26
UniProtKB ID: O75436, A8MZ56, B2RDD3, Q8TBH4, Q9H982
Gene ID:
Human(9559) Summary: This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(30930) vacuolar protein sorting 26 homolog A (yeast)
Rat(361846) vacuolar protein sorting 26 homolog A (S. pombe)
Thale Cress(835435) vacuolar protein sorting 26A
Horse(100072671) vacuolar protein sorting 26 homolog A (S. pombe)
domestic cat(101093645) vacuolar protein sorting 26 homolog A (S. pombe)
dog(479233) vacuolar protein sorting 26 homolog A (S. pombe)
chicken(423696) vacuolar protein sorting 26 homolog A (S. pombe)
Zebrafish(393881) vacuolar protein sorting 26 homolog A (yeast)
cow(510574) vacuolar protein sorting 26 homolog A (S. pombe)
sheep(101104294) vacuolar protein sorting 26 homolog A (S. pombe)
naked mole-rat(101707332) vacuolar protein sorting 26 homolog A (S. pombe)
domestic guinea pig(100726769) vacuolar protein sorting 26 homolog A (S. pombe)
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004896 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035260 Rosetta Predictions human pricing
NM_004896 Rosetta Predictions human pricing
NM_001007740 Rosetta Predictions rat pricing
NM_001113355 Rosetta Predictions mouse pricing
NM_133672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053098 predicted 410
2 SASI_Hs01_00053099 predicted 583
3 SASI_Hs01_00053100 predicted 423
4 SASI_Hs01_00053101 predicted 622
5 SASI_Hs01_00053102 predicted 491
6 SASI_Hs01_00053103 predicted 489
7 SASI_Hs01_00053105 predicted 425
8 SASI_Hs01_00053106 predicted 622
9 SASI_Hs01_00053107 predicted 448
10 SASI_Hs02_00308188 predicted 239
11 SASI_Hs01_00053104 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104031 predicted 405
2 SASI_Hs01_00104032 predicted 589
3 SASI_Hs01_00104033 predicted 429
4 SASI_Hs01_00104034 predicted 628
5 SASI_Hs01_00104036 predicted 486
6 SASI_Hs02_00338541 predicted 365
7 SASI_Hs01_00104037 predicted 1568
8 SASI_Hs01_00104039 predicted 452
9 SASI_Hs01_00104040 predicted 238
10 SASI_Hs02_00338542 predicted 598
11 SASI_Hs01_00104035 predicted 272
12 SASI_Hs01_00104038 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053524 predicted 805
2 SASI_Rn01_00053525 predicted 731
3 SASI_Rn01_00053526 predicted 278
4 SASI_Rn01_00053527 predicted 325
5 SASI_Rn01_00053528 predicted 482
6 SASI_Rn01_00053530 predicted 806
7 SASI_Rn01_00053531 predicted 857
8 SASI_Rn01_00053532 predicted 992
9 SASI_Rn01_00053533 predicted 228
10 SASI_Rn02_00198930 predicted 996
11 SASI_Rn01_00053529 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307473 predicted 947
2 SASI_Mm02_00307474 predicted 832
3 SASI_Mm02_00307475 predicted 861
4 SASI_Mm02_00307476 predicted 461
5 SASI_Mm02_00307477 predicted 939
6 SASI_Mm02_00307478 predicted 631
7 SASI_Mm02_00307479 predicted 757
8 SASI_Mm02_00307480 predicted 641
9 SASI_Mm02_00307481 predicted 1134
10 SASI_Mm02_00307482 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021552 predicted 878
2 SASI_Mm01_00021553 predicted 759
3 SASI_Mm02_00338619 predicted 795
4 SASI_Mm02_00338620 predicted 392
5 SASI_Mm01_00021555 predicted 873
6 SASI_Mm01_00021556 predicted 556
7 SASI_Mm01_00021557 predicted 691
8 SASI_Mm01_00021559 predicted 570
9 SASI_Mm01_00021561 predicted 1063
10 SASI_Mm02_00338621 predicted 464
11 SASI_Mm01_00021554 predicted 289
12 SASI_Mm01_00021558 predicted 240
13 SASI_Mm01_00021560 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004896
VPS26A MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 26 homolog A (S. pombe)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-371s21c1
Sequence:GTACCGGAGAGTAATACTCATGAATTTGCTCGAGCAAATTCATGAGTATTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-633s21c1
Sequence:GTACCGGCATTGAAGATTGTCTACATATCTCGAGATATGTAGACAATCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004896.3-1417s21c1
Sequence:GTACCGGATGTGAGTAGGCTGGTATTTGCTCGAGCAAATACCAGCCTACTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-859s21c1
Sequence:GTACCGGTCAATTCCAATAAGGCTATTTCTCGAGAAATAGCCTTATTGGAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004896.3-1488s21c1
Sequence:GTACCGGGGCTAATGATTACCTCTTATTCTCGAGAATAAGAGGTAATCATTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-155s21c1
Sequence:GTACCGGCAATTTGTGAGATCGATATTGCTCGAGCAATATCGATCTCACAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-1045s21c1
Sequence:GTACCGGACAAACTTTCACCAGCGATTTCTCGAGAAATCGCTGGTGAAAGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-107s1c1
Sequence:CCGGCCAATTTGTGAGATCGATATTCTCGAGAATATCGATCTCACAAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-521s1c1
Sequence:CCGGGATCTTATTGTTCACCAGCTTCTCGAGAAGCTGGTGAACAATAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-228s1c1
Sequence:CCGGGAAAGGTAAACCTAGCCTTTACTCGAGTAAAGGCTAGGTTTACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-551s1c1
Sequence:CCGGCCTGATGTTAACAACTCTATTCTCGAGAATAGAGTTGTTAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-996s1c1
Sequence:CCGGGAACAAACTTTCACCAGCGATCTCGAGATCGCTGGTGAAAGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004896
VPS26A MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 26 homolog A (S. pombe)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-371s21c1
Sequence:GTACCGGAGAGTAATACTCATGAATTTGCTCGAGCAAATTCATGAGTATTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-633s21c1
Sequence:GTACCGGCATTGAAGATTGTCTACATATCTCGAGATATGTAGACAATCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004896.3-1417s21c1
Sequence:GTACCGGATGTGAGTAGGCTGGTATTTGCTCGAGCAAATACCAGCCTACTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-859s21c1
Sequence:GTACCGGTCAATTCCAATAAGGCTATTTCTCGAGAAATAGCCTTATTGGAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004896.3-1488s21c1
Sequence:GTACCGGGGCTAATGATTACCTCTTATTCTCGAGAATAAGAGGTAATCATTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-155s21c1
Sequence:GTACCGGCAATTTGTGAGATCGATATTGCTCGAGCAATATCGATCTCACAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-1045s21c1
Sequence:GTACCGGACAAACTTTCACCAGCGATTTCTCGAGAAATCGCTGGTGAAAGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-107s1c1
Sequence:CCGGCCAATTTGTGAGATCGATATTCTCGAGAATATCGATCTCACAAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-521s1c1
Sequence:CCGGGATCTTATTGTTCACCAGCTTCTCGAGAAGCTGGTGAACAATAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-228s1c1
Sequence:CCGGGAAAGGTAAACCTAGCCTTTACTCGAGTAAAGGCTAGGTTTACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-551s1c1
Sequence:CCGGCCTGATGTTAACAACTCTATTCTCGAGAATAGAGTTGTTAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-996s1c1
Sequence:CCGGGAACAAACTTTCACCAGCGATCTCGAGATCGCTGGTGAAAGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004896
VPS26A MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 26 homolog A (S. pombe)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-371s21c1
Sequence:GTACCGGAGAGTAATACTCATGAATTTGCTCGAGCAAATTCATGAGTATTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-633s21c1
Sequence:GTACCGGCATTGAAGATTGTCTACATATCTCGAGATATGTAGACAATCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004896.3-1417s21c1
Sequence:GTACCGGATGTGAGTAGGCTGGTATTTGCTCGAGCAAATACCAGCCTACTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-859s21c1
Sequence:GTACCGGTCAATTCCAATAAGGCTATTTCTCGAGAAATAGCCTTATTGGAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004896.3-1488s21c1
Sequence:GTACCGGGGCTAATGATTACCTCTTATTCTCGAGAATAAGAGGTAATCATTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-155s21c1
Sequence:GTACCGGCAATTTGTGAGATCGATATTGCTCGAGCAATATCGATCTCACAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004896.3-1045s21c1
Sequence:GTACCGGACAAACTTTCACCAGCGATTTCTCGAGAAATCGCTGGTGAAAGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-107s1c1
Sequence:CCGGCCAATTTGTGAGATCGATATTCTCGAGAATATCGATCTCACAAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-521s1c1
Sequence:CCGGGATCTTATTGTTCACCAGCTTCTCGAGAAGCTGGTGAACAATAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-228s1c1
Sequence:CCGGGAAAGGTAAACCTAGCCTTTACTCGAGTAAAGGCTAGGTTTACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-551s1c1
Sequence:CCGGCCTGATGTTAACAACTCTATTCTCGAGAATAGAGTTGTTAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004896.2-996s1c1
Sequence:CCGGGAACAAACTTTCACCAGCGATCTCGAGATCGCTGGTGAAAGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133672
VALIDATED
VPS26A MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 26 homolog A (S. pombe)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000366611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-1241s21c1
Sequence:CCGGTCCTAGAGTGCTGCGTTTATTCTCGAGAATAAACGCAGCACTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-831s21c1
Sequence:CCGGCAATCGCTAAGTATGAAATAACTCGAGTTATTTCATACTTAGCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-574s21c1
Sequence:CCGGAGTGAAAGAGTACGATCTTATCTCGAGATAAGATCGTACTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-871s21c1
Sequence:CCGGAGGAGAATCTATTCCGATAAGCTCGAGCTTATCGGAATAGATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-390s21c1
Sequence:CCGGAGAGTAATACTCATGAATTTGCTCGAGCAAATTCATGAGTATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-1371s21c1
Sequence:CCGGTAAGCACTCAGAAGCATAAACCTCGAGGTTTATGCTTCTGAGTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133672.1-2015s1c1
Sequence:CCGGCCCGAACCAAACAGAACTAAACTCGAGTTTAGTTCTGTTTGGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-120s1c1
Sequence:CCGGCCCATTTGTGAGATTGATGTTCTCGAGAACATCAATCTCACAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-757s1c1
Sequence:CCGGGCACCACAACAGAGACAGAAACTCGAGTTTCTGTCTCTGTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-612s1c1
Sequence:CCGGCTGCACATAGAGTTTGAATATCTCGAGATATTCAAACTCTATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-564s1c1
Sequence:CCGGCCTGATGTCAACAACTCTATTCTCGAGAATAGAGTTGTTGACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133672
VALIDATED
VPS26A MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 26 homolog A (S. pombe)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000366611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-1241s21c1
Sequence:CCGGTCCTAGAGTGCTGCGTTTATTCTCGAGAATAAACGCAGCACTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-831s21c1
Sequence:CCGGCAATCGCTAAGTATGAAATAACTCGAGTTATTTCATACTTAGCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-574s21c1
Sequence:CCGGAGTGAAAGAGTACGATCTTATCTCGAGATAAGATCGTACTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-871s21c1
Sequence:CCGGAGGAGAATCTATTCCGATAAGCTCGAGCTTATCGGAATAGATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-390s21c1
Sequence:CCGGAGAGTAATACTCATGAATTTGCTCGAGCAAATTCATGAGTATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-1371s21c1
Sequence:CCGGTAAGCACTCAGAAGCATAAACCTCGAGGTTTATGCTTCTGAGTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133672.1-2015s1c1
Sequence:CCGGCCCGAACCAAACAGAACTAAACTCGAGTTTAGTTCTGTTTGGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-120s1c1
Sequence:CCGGCCCATTTGTGAGATTGATGTTCTCGAGAACATCAATCTCACAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-757s1c1
Sequence:CCGGGCACCACAACAGAGACAGAAACTCGAGTTTCTGTCTCTGTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-612s1c1
Sequence:CCGGCTGCACATAGAGTTTGAATATCTCGAGATATTCAAACTCTATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-564s1c1
Sequence:CCGGCCTGATGTCAACAACTCTATTCTCGAGAATAGAGTTGTTGACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133672
VALIDATED
VPS26A MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 26 homolog A (S. pombe)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000366611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-1241s21c1
Sequence:CCGGTCCTAGAGTGCTGCGTTTATTCTCGAGAATAAACGCAGCACTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-831s21c1
Sequence:CCGGCAATCGCTAAGTATGAAATAACTCGAGTTATTTCATACTTAGCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-574s21c1
Sequence:CCGGAGTGAAAGAGTACGATCTTATCTCGAGATAAGATCGTACTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-871s21c1
Sequence:CCGGAGGAGAATCTATTCCGATAAGCTCGAGCTTATCGGAATAGATTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-390s21c1
Sequence:CCGGAGAGTAATACTCATGAATTTGCTCGAGCAAATTCATGAGTATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133672.3-1371s21c1
Sequence:CCGGTAAGCACTCAGAAGCATAAACCTCGAGGTTTATGCTTCTGAGTGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133672.1-2015s1c1
Sequence:CCGGCCCGAACCAAACAGAACTAAACTCGAGTTTAGTTCTGTTTGGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-120s1c1
Sequence:CCGGCCCATTTGTGAGATTGATGTTCTCGAGAACATCAATCTCACAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-757s1c1
Sequence:CCGGGCACCACAACAGAGACAGAAACTCGAGTTTCTGTCTCTGTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-612s1c1
Sequence:CCGGCTGCACATAGAGTTTGAATATCTCGAGATATTCAAACTCTATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133672.1-564s1c1
Sequence:CCGGCCTGATGTCAACAACTCTATTCTCGAGAATAGAGTTGTTGACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks