EMAIL THIS PAGE TO A FRIEND

VPS26B

vacuolar protein sorting 26 homolog B (S. pombe)

Synonyms: Pep8b
UniProtKB ID: Q4G0F5, Q96A55
Gene ID:
Mouse(69091) vacuolar protein sorting 26 homolog B (yeast)
Rat(300472) vacuolar protein sorting 26 homolog B (S. pombe)
Thale Cress(828883) vacuolar protein sorting-associated protein 26B
chicken(419738) vacuolar protein sorting 26 homolog B (S. pombe)
domestic cat(101096510) vacuolar protein sorting 26 homolog B (S. pombe)
dog(607442) vacuolar protein sorting 26 homolog B (S. pombe)
Zebrafish(406684) vacuolar protein sorting 26 homolog B
domestic guinea pig(100720157) vacuolar protein sorting 26 homolog B (S. pombe)
naked mole-rat(101708860) vacuolar protein sorting 26 homolog B (S. pombe)
Domestic Rabbit(100347278) vacuolar protein sorting 26 homolog B (S. pombe)
cow(614321) vacuolar protein sorting 26 homolog B (S. pombe)
sheep(101115482) vacuolar protein sorting 26 homolog B (S. pombe)
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052875 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047241 MISSION® esiRNA esiRNA human VPS26B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052875 Rosetta Predictions human pricing
NM_001106809 Rosetta Predictions rat pricing
NM_178027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087280 predicted 657
2 SASI_Hs01_00087281 predicted 863
3 SASI_Hs01_00087282 predicted 821
4 SASI_Hs01_00087283 predicted 879
5 SASI_Hs01_00087285 predicted 1007
6 SASI_Hs01_00087286 predicted 646
7 SASI_Hs01_00087287 predicted 1240
8 SASI_Hs02_00361584 predicted 922
9 SASI_Hs01_00087288 predicted 883
10 SASI_Hs01_00087289 predicted 829
11 SASI_Hs01_00087284 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222618 predicted 641
2 SASI_Rn02_00222619 predicted 863
3 SASI_Rn02_00222620 predicted 620
4 SASI_Rn02_00222621 predicted 1232
5 SASI_Rn02_00222622 predicted 1196
6 SASI_Rn02_00222623 predicted 798
7 SASI_Rn02_00222624 predicted 779
8 SASI_Rn02_00222625 predicted 1117
9 SASI_Rn02_00222626 predicted 984
10 SASI_Rn02_00222627 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042540 predicted 864
2 SASI_Mm01_00042541 predicted 1235
3 SASI_Mm01_00042542 predicted 842
4 SASI_Mm01_00042543 predicted 1456
5 SASI_Mm01_00042544 predicted 798
6 SASI_Mm01_00042545 predicted 624
7 SASI_Mm01_00042546 predicted 1026
8 SASI_Mm01_00042547 predicted 944
9 SASI_Mm01_00042548 predicted 1118
10 SASI_Mm01_00042549 predicted 1415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178027
VPS26B MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 26 homolog B (S. pombe)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178027.3-3368s1c1
Sequence:CCGGCCATCCTTTAAGGTTCCCAAACTCGAGTTTGGGAACCTTAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-860s1c1
Sequence:CCGGGTTAAAGAGATGGACATTGTACTCGAGTACAATGTCCATCTCTTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-845s1c1
Sequence:CCGGCGCCTCAATGATGTTGTTAAACTCGAGTTTAACAACATCATTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-1021s1c1
Sequence:CCGGCCTGCTGGTGAGAATCAAGATCTCGAGATCTTGATTCTCACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-1024s1c1
Sequence:CCGGGCTGGTGAGAATCAAGATCAACTCGAGTTGATCTTGATTCTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1240s21c1
Sequence:GTACCGGCACCCACCATGCGTGACATAACTCGAGTTATGTCACGCATGGTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-839s21c1
Sequence:GTACCGGGAATGTGAAGCTCCGCTATTTCTCGAGAAATAGCGGAGCTTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178027.4-1686s21c1
Sequence:CCGGTGCAGCCTAGGTAGGGATAAGCTCGAGCTTATCCCTACCTAGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1147s21c1
Sequence:CCGGACGACACAATAGCGAAGTATGCTCGAGCATACTTCGCTATTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1265s21c1
Sequence:CCGGGAAGTTCTCTGTGCGCTATTACTCGAGTAATAGCGCACAGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-882s21c1
Sequence:CCGGCGCCTCAATGATGTTGTTAAACTCGAGTTTAACAACATCATTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1061s21c1
Sequence:CCGGGCTGGTGAGAATCAAGATCAACTCGAGTTGATCTTGATTCTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-688s21c1
Sequence:GTACCGGGGCAGATCGAACTCTACTATGCTCGAGCATAGTAGAGTTCGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178027
VPS26B MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 26 homolog B (S. pombe)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178027.3-3368s1c1
Sequence:CCGGCCATCCTTTAAGGTTCCCAAACTCGAGTTTGGGAACCTTAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-860s1c1
Sequence:CCGGGTTAAAGAGATGGACATTGTACTCGAGTACAATGTCCATCTCTTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-845s1c1
Sequence:CCGGCGCCTCAATGATGTTGTTAAACTCGAGTTTAACAACATCATTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-1021s1c1
Sequence:CCGGCCTGCTGGTGAGAATCAAGATCTCGAGATCTTGATTCTCACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-1024s1c1
Sequence:CCGGGCTGGTGAGAATCAAGATCAACTCGAGTTGATCTTGATTCTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1240s21c1
Sequence:GTACCGGCACCCACCATGCGTGACATAACTCGAGTTATGTCACGCATGGTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-839s21c1
Sequence:GTACCGGGAATGTGAAGCTCCGCTATTTCTCGAGAAATAGCGGAGCTTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178027.4-1686s21c1
Sequence:CCGGTGCAGCCTAGGTAGGGATAAGCTCGAGCTTATCCCTACCTAGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1147s21c1
Sequence:CCGGACGACACAATAGCGAAGTATGCTCGAGCATACTTCGCTATTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1265s21c1
Sequence:CCGGGAAGTTCTCTGTGCGCTATTACTCGAGTAATAGCGCACAGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-882s21c1
Sequence:CCGGCGCCTCAATGATGTTGTTAAACTCGAGTTTAACAACATCATTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1061s21c1
Sequence:CCGGGCTGGTGAGAATCAAGATCAACTCGAGTTGATCTTGATTCTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-688s21c1
Sequence:GTACCGGGGCAGATCGAACTCTACTATGCTCGAGCATAGTAGAGTTCGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178027
VPS26B MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 26 homolog B (S. pombe)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178027.3-3368s1c1
Sequence:CCGGCCATCCTTTAAGGTTCCCAAACTCGAGTTTGGGAACCTTAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-860s1c1
Sequence:CCGGGTTAAAGAGATGGACATTGTACTCGAGTACAATGTCCATCTCTTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-845s1c1
Sequence:CCGGCGCCTCAATGATGTTGTTAAACTCGAGTTTAACAACATCATTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-1021s1c1
Sequence:CCGGCCTGCTGGTGAGAATCAAGATCTCGAGATCTTGATTCTCACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178027.3-1024s1c1
Sequence:CCGGGCTGGTGAGAATCAAGATCAACTCGAGTTGATCTTGATTCTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1240s21c1
Sequence:GTACCGGCACCCACCATGCGTGACATAACTCGAGTTATGTCACGCATGGTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-839s21c1
Sequence:GTACCGGGAATGTGAAGCTCCGCTATTTCTCGAGAAATAGCGGAGCTTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178027.4-1686s21c1
Sequence:CCGGTGCAGCCTAGGTAGGGATAAGCTCGAGCTTATCCCTACCTAGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1147s21c1
Sequence:CCGGACGACACAATAGCGAAGTATGCTCGAGCATACTTCGCTATTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1265s21c1
Sequence:CCGGGAAGTTCTCTGTGCGCTATTACTCGAGTAATAGCGCACAGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-882s21c1
Sequence:CCGGCGCCTCAATGATGTTGTTAAACTCGAGTTTAACAACATCATTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-1061s21c1
Sequence:CCGGGCTGGTGAGAATCAAGATCAACTCGAGTTGATCTTGATTCTCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178027.4-688s21c1
Sequence:GTACCGGGGCAGATCGAACTCTACTATGCTCGAGCATAGTAGAGTTCGATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052875
VALIDATED
VPS26B MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 26 homolog B (S. pombe)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_052875.2-1220s1c1
Sequence:CCGGGCGGGACATCAACAAGAAGTTCTCGAGAACTTCTTGTTGATGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_052875.2-852s1c1
Sequence:CCGGCGCCTCAATGATGTTGTCAAACTCGAGTTTGACAACATCATTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052875.2-806s1c1
Sequence:CCGGGCAGAATGTGAAGCTACGCTACTCGAGTAGCGTAGCTTCACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052875.2-1052s1c1
Sequence:CCGGGCACATGGAGATAGACATCATCTCGAGATGATGTCTATCTCCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_052875.2-1002s1c1
Sequence:CCGGGATGTCATTGTAGGGAAGATACTCGAGTATCTTCCCTACAATGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-964s21c1
Sequence:GTACCGGGACTGTCTGCACATTGAATTTCTCGAGAAATTCAATGTGCAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-648s21c1
Sequence:GTACCGGGGGCATCAAGATCGAGTTCATCTCGAGATGAACTCGATCTTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-1248s21c1
Sequence:GTACCGGGAAGTTCTCTGTGCGCTATTACTCGAGTAATAGCGCACAGAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-670s21c1
Sequence:GTACCGGGGGCAGATCGAACTCTACTACCTCGAGGTAGTAGAGTTCGATCTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-866s21c1
Sequence:GTACCGGGCCTCAATGATGTTGTCAAAGCTCGAGCTTTGACAACATCATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-1136s21c1
Sequence:GTACCGGCGATAGCCAAGTACGAGATCACTCGAGTGATCTCGTACTTGGCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-1112s21c1
Sequence:GTACCGGCCAACGTGTACCATGAGAATGCTCGAGCATTCTCATGGTACACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-797s21c1
Sequence:GTACCGGAGCCGTATGAGTCCTACACAGCTCGAGCTGTGTAGGACTCATACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052875
VALIDATED
VPS26B MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 26 homolog B (S. pombe)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_052875.2-1220s1c1
Sequence:CCGGGCGGGACATCAACAAGAAGTTCTCGAGAACTTCTTGTTGATGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_052875.2-852s1c1
Sequence:CCGGCGCCTCAATGATGTTGTCAAACTCGAGTTTGACAACATCATTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052875.2-806s1c1
Sequence:CCGGGCAGAATGTGAAGCTACGCTACTCGAGTAGCGTAGCTTCACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052875.2-1052s1c1
Sequence:CCGGGCACATGGAGATAGACATCATCTCGAGATGATGTCTATCTCCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_052875.2-1002s1c1
Sequence:CCGGGATGTCATTGTAGGGAAGATACTCGAGTATCTTCCCTACAATGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-964s21c1
Sequence:GTACCGGGACTGTCTGCACATTGAATTTCTCGAGAAATTCAATGTGCAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-648s21c1
Sequence:GTACCGGGGGCATCAAGATCGAGTTCATCTCGAGATGAACTCGATCTTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-1248s21c1
Sequence:GTACCGGGAAGTTCTCTGTGCGCTATTACTCGAGTAATAGCGCACAGAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-670s21c1
Sequence:GTACCGGGGGCAGATCGAACTCTACTACCTCGAGGTAGTAGAGTTCGATCTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-866s21c1
Sequence:GTACCGGGCCTCAATGATGTTGTCAAAGCTCGAGCTTTGACAACATCATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-1136s21c1
Sequence:GTACCGGCGATAGCCAAGTACGAGATCACTCGAGTGATCTCGTACTTGGCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-1112s21c1
Sequence:GTACCGGCCAACGTGTACCATGAGAATGCTCGAGCATTCTCATGGTACACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-797s21c1
Sequence:GTACCGGAGCCGTATGAGTCCTACACAGCTCGAGCTGTGTAGGACTCATACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052875
VALIDATED
VPS26B MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 26 homolog B (S. pombe)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_052875.2-1220s1c1
Sequence:CCGGGCGGGACATCAACAAGAAGTTCTCGAGAACTTCTTGTTGATGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_052875.2-852s1c1
Sequence:CCGGCGCCTCAATGATGTTGTCAAACTCGAGTTTGACAACATCATTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052875.2-806s1c1
Sequence:CCGGGCAGAATGTGAAGCTACGCTACTCGAGTAGCGTAGCTTCACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_052875.2-1052s1c1
Sequence:CCGGGCACATGGAGATAGACATCATCTCGAGATGATGTCTATCTCCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_052875.2-1002s1c1
Sequence:CCGGGATGTCATTGTAGGGAAGATACTCGAGTATCTTCCCTACAATGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-964s21c1
Sequence:GTACCGGGACTGTCTGCACATTGAATTTCTCGAGAAATTCAATGTGCAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-648s21c1
Sequence:GTACCGGGGGCATCAAGATCGAGTTCATCTCGAGATGAACTCGATCTTGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-1248s21c1
Sequence:GTACCGGGAAGTTCTCTGTGCGCTATTACTCGAGTAATAGCGCACAGAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-670s21c1
Sequence:GTACCGGGGGCAGATCGAACTCTACTACCTCGAGGTAGTAGAGTTCGATCTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-866s21c1
Sequence:GTACCGGGCCTCAATGATGTTGTCAAAGCTCGAGCTTTGACAACATCATTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-1136s21c1
Sequence:GTACCGGCGATAGCCAAGTACGAGATCACTCGAGTGATCTCGTACTTGGCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-1112s21c1
Sequence:GTACCGGCCAACGTGTACCATGAGAATGCTCGAGCATTCTCATGGTACACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052875.3-797s21c1
Sequence:GTACCGGAGCCGTATGAGTCCTACACAGCTCGAGCTGTGTAGGACTCATACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks