EMAIL THIS PAGE TO A FRIEND

VPS28

vacuolar protein sorting 28 homolog (S. cerevisiae)

UniProtKB ID: Q9UK41, Q86VK0
Gene ID:
Human(51160) Summary: This gene encodes a protein subunit of the ESCRT-I complex (endosomal complexes required for transport), which functions in the transport and sorting of proteins into subcellular vesicles. This complex can also be hijacked to facilitate the budding of enveloped viruses from the cell membrane. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Mouse(66914) vacuolar protein sorting 28 (yeast)
Rat(300052) vacuolar protein sorting 28 homolog (S. cerevisiae)
fruit fly(47408) Vacuolar protein sorting 28
dog(607677) vacuolar protein sorting 28 homolog (S. cerevisiae)
domestic cat(101080944) vacuolar protein sorting 28 homolog (S. cerevisiae)
Zebrafish(393562) vacuolar protein sorting 28 (yeast)
cow(618785) vacuolar protein sorting 28 homolog (S. cerevisiae)
sheep(101107800) vacuolar protein sorting 28 homolog (S. cerevisiae)
naked mole-rat(101718157) vacuolar protein sorting 28 homolog (S. cerevisiae)
domestic guinea pig(100715567) vacuolar protein sorting 28 homolog (S. cerevisiae)
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016208 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000721 MISSION® esiRNA esiRNA targeting human VPS28 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016208 Rosetta Predictions human pricing
NM_183057 Rosetta Predictions human pricing
NM_001130492 Rosetta Predictions rat pricing
XM_216962 Rosetta Predictions rat pricing
NM_025842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019502 predicted 296
2 SASI_Hs01_00019503 predicted 399
3 SASI_Hs01_00019504 predicted 342
4 SASI_Hs01_00019505 predicted 363
5 SASI_Hs01_00019506 predicted 402
6 SASI_Hs01_00019507 predicted 373
7 SASI_Hs02_00349060 predicted 299
8 SASI_Hs01_00019508 predicted 396
9 SASI_Hs01_00019509 predicted 339
10 SASI_Hs01_00019510 predicted 337
11 SASI_Hs01_00019511 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190277 predicted 303
2 SASI_Hs01_00190278 predicted 395
3 SASI_Hs01_00190279 predicted 345
4 SASI_Hs01_00190280 predicted 360
5 SASI_Hs01_00190281 predicted 403
6 SASI_Hs01_00190282 predicted 369
7 SASI_Hs02_00371216 predicted 298
8 SASI_Hs01_00190283 predicted 399
9 SASI_Hs01_00190284 predicted 343
10 SASI_Hs01_00190285 predicted 342
11 SASI_Hs01_00190286 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255359 predicted 505
2 SASI_Rn02_00255360 predicted 472
3 SASI_Rn02_00255361 predicted 524
4 SASI_Rn02_00255362 predicted 559
5 SASI_Rn02_00255363 predicted 229
6 SASI_Rn02_00255364 predicted 678
7 SASI_Rn02_00255365 predicted 474
8 SASI_Rn02_00255366 predicted 448
9 SASI_Rn02_00255367 predicted 722
10 SASI_Rn02_00255368 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153041 predicted 511
2 SASI_Rn01_00153042 predicted 478
3 SASI_Rn01_00153043 predicted 533
4 SASI_Rn01_00153044 predicted 560
5 SASI_Rn01_00153045 predicted 225
6 SASI_Rn01_00153046 predicted 678
7 SASI_Rn01_00153047 predicted 476
8 SASI_Rn01_00153048 predicted 452
9 SASI_Rn01_00153049 predicted 724
10 SASI_Rn01_00153050 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329121 predicted 641
2 SASI_Mm01_00049332 predicted 415
3 SASI_Mm01_00049333 predicted 439
4 SASI_Mm01_00049334 predicted 551
5 SASI_Mm01_00049335 predicted 456
6 SASI_Mm01_00049336 predicted 351
7 SASI_Mm01_00049337 predicted 587
8 SASI_Mm01_00049338 predicted 460
9 SASI_Mm02_00329122 predicted 607
10 SASI_Mm01_00049340 predicted 628
11 SASI_Mm01_00049339 predicted 396
12 SASI_Mm01_00049341 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016208
VALIDATED
VPS28 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 28 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016208.2-435s21c1
Sequence:GTACCGGCATCACCATCAAGGACGACAACTCGAGTTGTCGTCCTTGATGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-717s21c1
Sequence:CCGGGTCAGCCTACAACGCCTTCAACTCGAGTTGAAGGCGTTGTAGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-881s21c1
Sequence:CCGGGTCTTTGGTGTCAGAACTTTGCTCGAGCAAAGTTCTGACACCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-489s21c1
Sequence:CCGGCTCGCTCTTCATCACGGTCATCTCGAGATGACCGTGATGAAGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-186s21c1
Sequence:CCGGGAGGGAGAAGTACGACAACATCTCGAGATGTTGTCGTACTTCTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-220s21c1
Sequence:CCGGGCGGTGGTGAAGACAATGCAACTCGAGTTGCATTGTCTTCACCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016208.2-346s21c1
Sequence:GTACCGGGGCTCAGAAATCAGCTCTATTCTCGAGAATAGAGCTGATTTCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016208.2-840s21c1
Sequence:GTACCGGATCCACACAACTCACTGTCTGCTCGAGCAGACAGTGAGTTGTGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016208.2-305s21c1
Sequence:GTACCGGGGCTCCTGGTCCAATACAAAGCTCGAGCTTTGTATTGGACCAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016208.x-220s1c1
Sequence:CCGGGCGGTGGTGAAGACAATGCAACTCGAGTTGCATTGTCTTCACCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016208.x-717s1c1
Sequence:CCGGGTCAGCCTACAACGCCTTCAACTCGAGTTGAAGGCGTTGTAGGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016208.x-489s1c1
Sequence:CCGGCTCGCTCTTCATCACGGTCATCTCGAGATGACCGTGATGAAGAGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_016208.x-186s1c1
Sequence:CCGGGAGGGAGAAGTACGACAACATCTCGAGATGTTGTCGTACTTCTCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016208.x-210s1c1
Sequence:CCGGAGAGCTGTTTGCGGTGGTGAACTCGAGTTCACCACCGCAAACAGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016208
VALIDATED
VPS28 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 28 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016208.2-435s21c1
Sequence:GTACCGGCATCACCATCAAGGACGACAACTCGAGTTGTCGTCCTTGATGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-717s21c1
Sequence:CCGGGTCAGCCTACAACGCCTTCAACTCGAGTTGAAGGCGTTGTAGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-881s21c1
Sequence:CCGGGTCTTTGGTGTCAGAACTTTGCTCGAGCAAAGTTCTGACACCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-489s21c1
Sequence:CCGGCTCGCTCTTCATCACGGTCATCTCGAGATGACCGTGATGAAGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-186s21c1
Sequence:CCGGGAGGGAGAAGTACGACAACATCTCGAGATGTTGTCGTACTTCTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-220s21c1
Sequence:CCGGGCGGTGGTGAAGACAATGCAACTCGAGTTGCATTGTCTTCACCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016208.2-346s21c1
Sequence:GTACCGGGGCTCAGAAATCAGCTCTATTCTCGAGAATAGAGCTGATTTCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016208.2-840s21c1
Sequence:GTACCGGATCCACACAACTCACTGTCTGCTCGAGCAGACAGTGAGTTGTGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016208.2-305s21c1
Sequence:GTACCGGGGCTCCTGGTCCAATACAAAGCTCGAGCTTTGTATTGGACCAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016208.x-220s1c1
Sequence:CCGGGCGGTGGTGAAGACAATGCAACTCGAGTTGCATTGTCTTCACCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016208.x-717s1c1
Sequence:CCGGGTCAGCCTACAACGCCTTCAACTCGAGTTGAAGGCGTTGTAGGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016208.x-489s1c1
Sequence:CCGGCTCGCTCTTCATCACGGTCATCTCGAGATGACCGTGATGAAGAGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_016208.x-186s1c1
Sequence:CCGGGAGGGAGAAGTACGACAACATCTCGAGATGTTGTCGTACTTCTCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016208.x-210s1c1
Sequence:CCGGAGAGCTGTTTGCGGTGGTGAACTCGAGTTCACCACCGCAAACAGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016208
VALIDATED
VPS28 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 28 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016208.2-435s21c1
Sequence:GTACCGGCATCACCATCAAGGACGACAACTCGAGTTGTCGTCCTTGATGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-717s21c1
Sequence:CCGGGTCAGCCTACAACGCCTTCAACTCGAGTTGAAGGCGTTGTAGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-881s21c1
Sequence:CCGGGTCTTTGGTGTCAGAACTTTGCTCGAGCAAAGTTCTGACACCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-489s21c1
Sequence:CCGGCTCGCTCTTCATCACGGTCATCTCGAGATGACCGTGATGAAGAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-186s21c1
Sequence:CCGGGAGGGAGAAGTACGACAACATCTCGAGATGTTGTCGTACTTCTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016208.2-220s21c1
Sequence:CCGGGCGGTGGTGAAGACAATGCAACTCGAGTTGCATTGTCTTCACCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016208.2-346s21c1
Sequence:GTACCGGGGCTCAGAAATCAGCTCTATTCTCGAGAATAGAGCTGATTTCTGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016208.2-840s21c1
Sequence:GTACCGGATCCACACAACTCACTGTCTGCTCGAGCAGACAGTGAGTTGTGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016208.2-305s21c1
Sequence:GTACCGGGGCTCCTGGTCCAATACAAAGCTCGAGCTTTGTATTGGACCAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016208.x-220s1c1
Sequence:CCGGGCGGTGGTGAAGACAATGCAACTCGAGTTGCATTGTCTTCACCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016208.x-717s1c1
Sequence:CCGGGTCAGCCTACAACGCCTTCAACTCGAGTTGAAGGCGTTGTAGGCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016208.x-489s1c1
Sequence:CCGGCTCGCTCTTCATCACGGTCATCTCGAGATGACCGTGATGAAGAGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_016208.x-186s1c1
Sequence:CCGGGAGGGAGAAGTACGACAACATCTCGAGATGTTGTCGTACTTCTCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_016208.x-210s1c1
Sequence:CCGGAGAGCTGTTTGCGGTGGTGAACTCGAGTTCACCACCGCAAACAGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025842
VALIDATED
VPS28 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 28 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-184s21c1
Sequence:CCGGACAACATGGCAGAGCTCTTTGCTCGAGCAAAGAGCTCTGCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-555s21c1
Sequence:CCGGATGGAGACAATGCACAGAATGCTCGAGCATTCTGTGCATTGTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.3-336s1c1
Sequence:CCGGGAGATCAGCTCCATTGATGAACTCGAGTTCATCAATGGAGCTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-677s21c1
Sequence:CCGGTCGCCAGATGCTCTTCGATCTCTCGAGAGATCGAAGAGCATCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-701s21c1
Sequence:CCGGGTCCGCTTACAACGCCTTTAACTCGAGTTAAAGGCGTTGTAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-431s21c1
Sequence:CCGGAGACGACAAGGGCAATCTCAACTCGAGTTGAGATTGCCCTTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.1-454s1c1
Sequence:CCGGCGCTGCATTGCAGATGTTGTTCTCGAGAACAACATCTGCAATGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.1-128s1c1
Sequence:CCGGCGGAGCTGTATGAGGAAGTAACTCGAGTTACTTCCTCATACAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.1-239s1c1
Sequence:CCGGCGTACATCAAGGACTGTGTCACTCGAGTGACACAGTCCTTGATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025842
VALIDATED
VPS28 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 28 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-184s21c1
Sequence:CCGGACAACATGGCAGAGCTCTTTGCTCGAGCAAAGAGCTCTGCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-555s21c1
Sequence:CCGGATGGAGACAATGCACAGAATGCTCGAGCATTCTGTGCATTGTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.3-336s1c1
Sequence:CCGGGAGATCAGCTCCATTGATGAACTCGAGTTCATCAATGGAGCTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-677s21c1
Sequence:CCGGTCGCCAGATGCTCTTCGATCTCTCGAGAGATCGAAGAGCATCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-701s21c1
Sequence:CCGGGTCCGCTTACAACGCCTTTAACTCGAGTTAAAGGCGTTGTAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-431s21c1
Sequence:CCGGAGACGACAAGGGCAATCTCAACTCGAGTTGAGATTGCCCTTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.1-454s1c1
Sequence:CCGGCGCTGCATTGCAGATGTTGTTCTCGAGAACAACATCTGCAATGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.1-128s1c1
Sequence:CCGGCGGAGCTGTATGAGGAAGTAACTCGAGTTACTTCCTCATACAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.1-239s1c1
Sequence:CCGGCGTACATCAAGGACTGTGTCACTCGAGTGACACAGTCCTTGATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025842
VALIDATED
VPS28 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 28 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-184s21c1
Sequence:CCGGACAACATGGCAGAGCTCTTTGCTCGAGCAAAGAGCTCTGCCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-555s21c1
Sequence:CCGGATGGAGACAATGCACAGAATGCTCGAGCATTCTGTGCATTGTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.3-336s1c1
Sequence:CCGGGAGATCAGCTCCATTGATGAACTCGAGTTCATCAATGGAGCTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-677s21c1
Sequence:CCGGTCGCCAGATGCTCTTCGATCTCTCGAGAGATCGAAGAGCATCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-701s21c1
Sequence:CCGGGTCCGCTTACAACGCCTTTAACTCGAGTTAAAGGCGTTGTAAGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025842.3-431s21c1
Sequence:CCGGAGACGACAAGGGCAATCTCAACTCGAGTTGAGATTGCCCTTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.1-454s1c1
Sequence:CCGGCGCTGCATTGCAGATGTTGTTCTCGAGAACAACATCTGCAATGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.1-128s1c1
Sequence:CCGGCGGAGCTGTATGAGGAAGTAACTCGAGTTACTTCCTCATACAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_025842.1-239s1c1
Sequence:CCGGCGTACATCAAGGACTGTGTCACTCGAGTGACACAGTCCTTGATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks