EMAIL THIS PAGE TO A FRIEND

VPS29

vacuolar protein sorting 29 homolog (S. cerevisiae)

Synonyms: DC15 PEP11
Gene ID:
Human(51699) Summary: This gene belongs to a group of vacuolar protein sorting (VPS) genes that, when functionally impaired, disrupt the efficient delivery of vacuolar hydrolases. The protein encoded by this gene is a component of a large multimeric complex, termed the retromer complex, which is involved in retrograde transport of proteins from endosomes to the trans-Golgi network. This VPS protein may be involved in the formation of the inner shell of the retromer coat for retrograde vesicles leaving the prevacuolar compartment. Alternative splice variants encoding different isoforms, and usage of multiple polyadenylation sites have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(56433) vacuolar protein sorting 29 (S. pombe)
Rat(288666) vacuolar protein sorting 29 homolog (S. cerevisiae)
Zebrafish(573437) vacuolar protein sorting 29 (yeast)
domestic cat(101099592) vacuolar protein sorting 29 homolog (S. cerevisiae)
chicken(416867) vacuolar protein sorting 29 homolog (S. cerevisiae)
dog(477477) vacuolar protein sorting 29 homolog (S. cerevisiae)
domestic guinea pig(100717710) vacuolar protein sorting 29 homolog (S. cerevisiae)
naked mole-rat(101717156) vacuolar protein sorting 29 homolog (S. cerevisiae)
cow(513840) vacuolar protein sorting 29 homolog (S. cerevisiae)
sheep(101105282) vacuolar protein sorting 29 homolog (S. cerevisiae)
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016226 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065121 MISSION® esiRNA esiRNA human VPS29 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016226 Rosetta Predictions human pricing
NM_057180 Rosetta Predictions human pricing
NM_001105932 Rosetta Predictions rat pricing
NM_019780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178785 predicted 269
2 SASI_Hs02_00349085 predicted 304
3 SASI_Hs02_00349086 predicted 273
4 SASI_Hs02_00349087 predicted 308
5 SASI_Hs01_00178787 predicted 308
6 SASI_Hs01_00178788 predicted 356
7 SASI_Hs01_00178789 predicted 343
8 SASI_Hs01_00178791 predicted 350
9 SASI_Hs01_00178792 predicted 350
10 SASI_Hs01_00178793 predicted 280
11 SASI_Hs01_00178786 predicted 410
12 SASI_Hs01_00178790 predicted 376
13 SASI_Hs01_00178794 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099431 predicted 282
2 SASI_Hs02_00362049 predicted 320
3 SASI_Hs02_00362050 predicted 288
4 SASI_Hs02_00362051 predicted 314
5 SASI_Hs01_00099433 predicted 319
6 SASI_Hs01_00099434 predicted 368
7 SASI_Hs01_00099435 predicted 354
8 SASI_Hs01_00099437 predicted 368
9 SASI_Hs01_00099438 predicted 365
10 SASI_Hs01_00099439 predicted 288
11 SASI_Hs01_00099432 predicted 418
12 SASI_Hs01_00099436 predicted 391
13 SASI_Hs01_00099440 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213962 predicted 751
2 SASI_Rn02_00213963 predicted 573
3 SASI_Rn02_00213964 predicted 209
4 SASI_Rn02_00213965 predicted 808
5 SASI_Rn02_00213966 predicted 663
6 SASI_Rn02_00213967 predicted 806
7 SASI_Rn02_00213968 predicted 579
8 SASI_Rn02_00213969 predicted 763
9 SASI_Rn02_00213970 predicted 692
10 SASI_Rn02_00213971 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324981 predicted 366
2 SASI_Mm01_00177500 predicted 744
3 SASI_Mm02_00324982 predicted 523
4 SASI_Mm01_00177501 predicted 557
5 SASI_Mm01_00177502 predicted 400
6 SASI_Mm01_00177503 predicted 736
7 SASI_Mm01_00177504 predicted 668
8 SASI_Mm02_00324983 predicted 237
9 SASI_Mm01_00177505 predicted 472
10 SASI_Mm01_00177506 predicted 554
11 SASI_Mm01_00177498 predicted 654
12 SASI_Mm01_00177499 predicted 375
13 SASI_Mm01_00177507 predicted 600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019780
VALIDATED
VPS29 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 29 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019780.1-838s1c1
Sequence:CCGGCGTTAGGAAGTTGTCCTTGTACTCGAGTACAAGGACAACTTCCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-542s1c1
Sequence:CCGGGTCACTTACGTCTATCAACTACTCGAGTAGTTGATAGACGTAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-539s1c1
Sequence:CCGGGTGGTCACTTACGTCTATCAACTCGAGTTGATAGACGTAAGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-295s1c1
Sequence:CCGGCCAGTTCAAGATCGGTCTGATCTCGAGATCAGACCGATCTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-482s1c1
Sequence:CCGGGCCTTGGAAACAAACATTATTCTCGAGAATAATGTTTGTTTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-314s21c1
Sequence:GTACCGGATCCACGGACACCAAGTTATTCTCGAGAATAACTTGGTGTCCGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-617s21c1
Sequence:CCGGGCTGGTCTCCACCACTTATTTCTCGAGAAATAAGTGGTGGAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-186s21c1
Sequence:CCGGCCAAGGAGAGCTACGACTATCCTCGAGGATAGTCGTAGCTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019780.1-735s21c1
Sequence:GTACCGGTAATCCATAGTTGCTCTAAAGCTCGAGCTTTAGAGCAACTATGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019780.1-539s21c1
Sequence:CCGGGTGGTCACTTACGTCTATCAACTCGAGTTGATAGACGTAAGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019780.1-482s21c1
Sequence:CCGGGCCTTGGAAACAAACATTATTCTCGAGAATAATGTTTGTTTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-581s21c1
Sequence:CCGGGTAGAACGAATTGAGTATAAACTCGAGTTTATACTCAATTCGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019780
VALIDATED
VPS29 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 29 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019780.1-838s1c1
Sequence:CCGGCGTTAGGAAGTTGTCCTTGTACTCGAGTACAAGGACAACTTCCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-542s1c1
Sequence:CCGGGTCACTTACGTCTATCAACTACTCGAGTAGTTGATAGACGTAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-539s1c1
Sequence:CCGGGTGGTCACTTACGTCTATCAACTCGAGTTGATAGACGTAAGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-295s1c1
Sequence:CCGGCCAGTTCAAGATCGGTCTGATCTCGAGATCAGACCGATCTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-482s1c1
Sequence:CCGGGCCTTGGAAACAAACATTATTCTCGAGAATAATGTTTGTTTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-314s21c1
Sequence:GTACCGGATCCACGGACACCAAGTTATTCTCGAGAATAACTTGGTGTCCGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-617s21c1
Sequence:CCGGGCTGGTCTCCACCACTTATTTCTCGAGAAATAAGTGGTGGAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-186s21c1
Sequence:CCGGCCAAGGAGAGCTACGACTATCCTCGAGGATAGTCGTAGCTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019780.1-735s21c1
Sequence:GTACCGGTAATCCATAGTTGCTCTAAAGCTCGAGCTTTAGAGCAACTATGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019780.1-539s21c1
Sequence:CCGGGTGGTCACTTACGTCTATCAACTCGAGTTGATAGACGTAAGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019780.1-482s21c1
Sequence:CCGGGCCTTGGAAACAAACATTATTCTCGAGAATAATGTTTGTTTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-581s21c1
Sequence:CCGGGTAGAACGAATTGAGTATAAACTCGAGTTTATACTCAATTCGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019780
VALIDATED
VPS29 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 29 homolog (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111585    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019780.1-838s1c1
Sequence:CCGGCGTTAGGAAGTTGTCCTTGTACTCGAGTACAAGGACAACTTCCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-542s1c1
Sequence:CCGGGTCACTTACGTCTATCAACTACTCGAGTAGTTGATAGACGTAAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-539s1c1
Sequence:CCGGGTGGTCACTTACGTCTATCAACTCGAGTTGATAGACGTAAGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-295s1c1
Sequence:CCGGCCAGTTCAAGATCGGTCTGATCTCGAGATCAGACCGATCTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019780.1-482s1c1
Sequence:CCGGGCCTTGGAAACAAACATTATTCTCGAGAATAATGTTTGTTTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-314s21c1
Sequence:GTACCGGATCCACGGACACCAAGTTATTCTCGAGAATAACTTGGTGTCCGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-617s21c1
Sequence:CCGGGCTGGTCTCCACCACTTATTTCTCGAGAAATAAGTGGTGGAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-186s21c1
Sequence:CCGGCCAAGGAGAGCTACGACTATCCTCGAGGATAGTCGTAGCTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019780.1-735s21c1
Sequence:GTACCGGTAATCCATAGTTGCTCTAAAGCTCGAGCTTTAGAGCAACTATGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019780.1-539s21c1
Sequence:CCGGGTGGTCACTTACGTCTATCAACTCGAGTTGATAGACGTAAGTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019780.1-482s21c1
Sequence:CCGGGCCTTGGAAACAAACATTATTCTCGAGAATAATGTTTGTTTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019780.1-581s21c1
Sequence:CCGGGTAGAACGAATTGAGTATAAACTCGAGTTTATACTCAATTCGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016226
VALIDATED
VPS29 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 29 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016226.2-502s1c1
Sequence:CCGGCCATCATTTGTGTTGATGGATCTCGAGATCCATCAACACAAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-104s1c1
Sequence:CCGGGCAACAGTTTGCCAGCTAAATCTCGAGATTTAGCTGGCAAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-178s1c1
Sequence:CCGGCTTTGCACCAAAGAGAGTTATCTCGAGATAACTCTCTTTGGTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-177s1c1
Sequence:CCGGCCTTTGCACCAAAGAGAGTTACTCGAGTAACTCTCTTTGGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-763s1c1
Sequence:CCGGGCTTCCTGTAAACTATAAGAACTCGAGTTCTTATAGTTTACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-177s21c1
Sequence:CCGGCCTTTGCACCAAAGAGAGTTACTCGAGTAACTCTCTTTGGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-104s21c1
Sequence:CCGGGCAACAGTTTGCCAGCTAAATCTCGAGATTTAGCTGGCAAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-313s21c1
Sequence:CCGGATCCATGGACATCAAGTTATTCTCGAGAATAACTTGATGTCCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-544s21c1
Sequence:CCGGACCTATGTGTATCAGCTAATTCTCGAGAATTAGCTGATACACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-728s21c1
Sequence:CCGGATACCATCTTCTCTGTTAATACTCGAGTATTAACAGAGAAGATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016226.3-576s21c1
Sequence:GTACCGGGAAAGTAGAACGAATCGAATACTCGAGTATTCGATTCGTTCTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016226.3-359s21c1
Sequence:GTACCGGCCCTGTTGCAGAGGCAATTTGCTCGAGCAAATTGCCTCTGCAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016226
VALIDATED
VPS29 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 29 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016226.2-502s1c1
Sequence:CCGGCCATCATTTGTGTTGATGGATCTCGAGATCCATCAACACAAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-104s1c1
Sequence:CCGGGCAACAGTTTGCCAGCTAAATCTCGAGATTTAGCTGGCAAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-178s1c1
Sequence:CCGGCTTTGCACCAAAGAGAGTTATCTCGAGATAACTCTCTTTGGTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-177s1c1
Sequence:CCGGCCTTTGCACCAAAGAGAGTTACTCGAGTAACTCTCTTTGGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-763s1c1
Sequence:CCGGGCTTCCTGTAAACTATAAGAACTCGAGTTCTTATAGTTTACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-177s21c1
Sequence:CCGGCCTTTGCACCAAAGAGAGTTACTCGAGTAACTCTCTTTGGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-104s21c1
Sequence:CCGGGCAACAGTTTGCCAGCTAAATCTCGAGATTTAGCTGGCAAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-313s21c1
Sequence:CCGGATCCATGGACATCAAGTTATTCTCGAGAATAACTTGATGTCCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-544s21c1
Sequence:CCGGACCTATGTGTATCAGCTAATTCTCGAGAATTAGCTGATACACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-728s21c1
Sequence:CCGGATACCATCTTCTCTGTTAATACTCGAGTATTAACAGAGAAGATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016226.3-576s21c1
Sequence:GTACCGGGAAAGTAGAACGAATCGAATACTCGAGTATTCGATTCGTTCTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016226.3-359s21c1
Sequence:GTACCGGCCCTGTTGCAGAGGCAATTTGCTCGAGCAAATTGCCTCTGCAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016226
VALIDATED
VPS29 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 29 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016226.2-502s1c1
Sequence:CCGGCCATCATTTGTGTTGATGGATCTCGAGATCCATCAACACAAATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-104s1c1
Sequence:CCGGGCAACAGTTTGCCAGCTAAATCTCGAGATTTAGCTGGCAAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-178s1c1
Sequence:CCGGCTTTGCACCAAAGAGAGTTATCTCGAGATAACTCTCTTTGGTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-177s1c1
Sequence:CCGGCCTTTGCACCAAAGAGAGTTACTCGAGTAACTCTCTTTGGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_016226.2-763s1c1
Sequence:CCGGGCTTCCTGTAAACTATAAGAACTCGAGTTCTTATAGTTTACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-177s21c1
Sequence:CCGGCCTTTGCACCAAAGAGAGTTACTCGAGTAACTCTCTTTGGTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-104s21c1
Sequence:CCGGGCAACAGTTTGCCAGCTAAATCTCGAGATTTAGCTGGCAAACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-313s21c1
Sequence:CCGGATCCATGGACATCAAGTTATTCTCGAGAATAACTTGATGTCCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-544s21c1
Sequence:CCGGACCTATGTGTATCAGCTAATTCTCGAGAATTAGCTGATACACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_016226.3-728s21c1
Sequence:CCGGATACCATCTTCTCTGTTAATACTCGAGTATTAACAGAGAAGATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016226.3-576s21c1
Sequence:GTACCGGGAAAGTAGAACGAATCGAATACTCGAGTATTCGATTCGTTCTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016226.3-359s21c1
Sequence:GTACCGGCCCTGTTGCAGAGGCAATTTGCTCGAGCAAATTGCCTCTGCAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks