EMAIL THIS PAGE TO A FRIEND

VPS33A

vacuolar protein sorting 33 homolog A (S. cerevisiae)

UniProtKB ID: Q96AX1, Q547V4, Q9H5Q0
Gene ID:
Human(65082) Summary: Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
Mouse(77573) vacuolar protein sorting 33A (yeast)
Rat(65081) vacuolar protein sorting 33 homolog A (S. cerevisiae)
cow(510197) vacuolar protein sorting 33 homolog A (S. cerevisiae)
sheep(101121712) vacuolar protein sorting 33 homolog A (S. cerevisiae)
naked mole-rat(101710168) vacuolar protein sorting 33 homolog A (S. cerevisiae)
Domestic Rabbit(100344276) vacuolar protein sorting 33 homolog A (S. cerevisiae)
domestic guinea pig(100724252) vacuolar protein sorting 33 homolog A (S. cerevisiae)
Zebrafish(448942) vacuolar protein sorting 33A
Horse(100058750) vacuolar protein sorting 33 homolog A (S. cerevisiae)
dog(477462) vacuolar protein sorting 33 homolog A (S. cerevisiae)
chicken(416861) vacuolar protein sorting 33 homolog A (S. cerevisiae)
Zebrafish(100332420) vacuolar protein sorting 33 homolog A (S. cerevisiae)
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022916 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022916 Rosetta Predictions human pricing
NM_022961 Rosetta Predictions rat pricing
NM_029929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073211 predicted 870
2 SASI_Hs01_00073212 predicted 1278
3 SASI_Hs01_00073213 predicted 554
4 SASI_Hs01_00073214 predicted 789
5 SASI_Hs01_00073215 predicted 1352
6 SASI_Hs01_00073216 predicted 843
7 SASI_Hs01_00073218 predicted 1200
8 SASI_Hs01_00073219 predicted 791
9 SASI_Hs01_00073220 predicted 841
10 SASI_Hs02_00356245 predicted 1109
11 SASI_Hs01_00073217 predicted 1357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050873 predicted 802
2 SASI_Rn01_00050874 predicted 1218
3 SASI_Rn01_00050875 predicted 685
4 SASI_Rn01_00050876 predicted 1465
5 SASI_Rn01_00050877 predicted 948
6 SASI_Rn01_00050879 predicted 1732
7 SASI_Rn01_00050880 predicted 677
8 SASI_Rn01_00050881 predicted 1080
9 SASI_Rn01_00050882 predicted 399
10 SASI_Rn02_00263700 predicted 404
11 SASI_Rn01_00050878 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076981 predicted 1127
2 SASI_Mm01_00076982 predicted 956
3 SASI_Mm01_00076984 predicted 818
4 SASI_Mm01_00076985 predicted 1843
5 SASI_Mm01_00076986 predicted 778
6 SASI_Mm01_00076987 predicted 301
7 SASI_Mm01_00076988 predicted 1697
8 SASI_Mm01_00076989 predicted 756
9 SASI_Mm01_00076990 predicted 1176
10 SASI_Mm02_00336209 predicted 1088
11 SASI_Mm01_00076983 predicted 1346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029929
VALIDATED
VPS33A MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 33 homolog A (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029929.3-181s21c1
Sequence:GTACCGGCGCACAGTACTCACTACTAAACTCGAGTTTAGTAGTGAGTACTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029929.3-1954s21c1
Sequence:GTACCGGCTCTATGCTCTTAATCCTAAACTCGAGTTTAGGATTAAGAGCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029929.3-1304s21c1
Sequence:GTACCGGCAGAAGGTGCTGGACTATTACCTCGAGGTAATAGTCCAGCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029929.3-1760s21c1
Sequence:GTACCGGTATGTCATTGCGACCACTAAACTCGAGTTTAGTGGTCGCAATGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029929.3-1694s21c1
Sequence:GTACCGGGGCGTCACCTTTGCGGAAATACTCGAGTATTTCCGCAAAGGTGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029929.3-2265s21c1
Sequence:GTACCGGCTGATCCACAGTGGCATATTCCTCGAGGAATATGCCACTGTGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029929.2-2153s1c1
Sequence:CCGGGCTAAGACTATGGGTCTGATACTCGAGTATCAGACCCATAGTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029929.2-423s1c1
Sequence:CCGGCCTTTATTCATCGAGAAGAATCTCGAGATTCTTCTCGATGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029929.2-245s1c1
Sequence:CCGGGCTGATGTCAAGAACATCATTCTCGAGAATGATGTTCTTGACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029929.2-1177s1c1
Sequence:CCGGCGGGATAGACACTGATAAGGTCTCGAGACCTTATCAGTGTCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029929.2-1760s1c1
Sequence:CCGGGCGACCACTAAACTGATGAATCTCGAGATTCATCAGTTTAGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029929
VALIDATED
VPS33A MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 33 homolog A (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029929.3-181s21c1
Sequence:GTACCGGCGCACAGTACTCACTACTAAACTCGAGTTTAGTAGTGAGTACTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029929.3-1954s21c1
Sequence:GTACCGGCTCTATGCTCTTAATCCTAAACTCGAGTTTAGGATTAAGAGCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029929.3-1304s21c1
Sequence:GTACCGGCAGAAGGTGCTGGACTATTACCTCGAGGTAATAGTCCAGCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029929.3-1760s21c1
Sequence:GTACCGGTATGTCATTGCGACCACTAAACTCGAGTTTAGTGGTCGCAATGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029929.3-1694s21c1
Sequence:GTACCGGGGCGTCACCTTTGCGGAAATACTCGAGTATTTCCGCAAAGGTGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029929.3-2265s21c1
Sequence:GTACCGGCTGATCCACAGTGGCATATTCCTCGAGGAATATGCCACTGTGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029929.2-2153s1c1
Sequence:CCGGGCTAAGACTATGGGTCTGATACTCGAGTATCAGACCCATAGTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029929.2-423s1c1
Sequence:CCGGCCTTTATTCATCGAGAAGAATCTCGAGATTCTTCTCGATGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029929.2-245s1c1
Sequence:CCGGGCTGATGTCAAGAACATCATTCTCGAGAATGATGTTCTTGACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029929.2-1177s1c1
Sequence:CCGGCGGGATAGACACTGATAAGGTCTCGAGACCTTATCAGTGTCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029929.2-1760s1c1
Sequence:CCGGGCGACCACTAAACTGATGAATCTCGAGATTCATCAGTTTAGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029929
VALIDATED
VPS33A MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 33 homolog A (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029929.3-181s21c1
Sequence:GTACCGGCGCACAGTACTCACTACTAAACTCGAGTTTAGTAGTGAGTACTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029929.3-1954s21c1
Sequence:GTACCGGCTCTATGCTCTTAATCCTAAACTCGAGTTTAGGATTAAGAGCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029929.3-1304s21c1
Sequence:GTACCGGCAGAAGGTGCTGGACTATTACCTCGAGGTAATAGTCCAGCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029929.3-1760s21c1
Sequence:GTACCGGTATGTCATTGCGACCACTAAACTCGAGTTTAGTGGTCGCAATGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029929.3-1694s21c1
Sequence:GTACCGGGGCGTCACCTTTGCGGAAATACTCGAGTATTTCCGCAAAGGTGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029929.3-2265s21c1
Sequence:GTACCGGCTGATCCACAGTGGCATATTCCTCGAGGAATATGCCACTGTGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029929.2-2153s1c1
Sequence:CCGGGCTAAGACTATGGGTCTGATACTCGAGTATCAGACCCATAGTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029929.2-423s1c1
Sequence:CCGGCCTTTATTCATCGAGAAGAATCTCGAGATTCTTCTCGATGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029929.2-245s1c1
Sequence:CCGGGCTGATGTCAAGAACATCATTCTCGAGAATGATGTTCTTGACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029929.2-1177s1c1
Sequence:CCGGCGGGATAGACACTGATAAGGTCTCGAGACCTTATCAGTGTCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029929.2-1760s1c1
Sequence:CCGGGCGACCACTAAACTGATGAATCTCGAGATTCATCAGTTTAGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022916
VALIDATED
VPS33A MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 33 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-277s1c1
Sequence:CCGGCGGCAGCTGATGTGAAGAATACTCGAGTATTCTTCACATCAGCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-316s1c1
Sequence:CCGGCCAGGCTAGAGTTGATGGATACTCGAGTATCCATCAACTCTAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022916.3-2209s1c1
Sequence:CCGGGCCATGGTGTTTCACCATGTTCTCGAGAACATGGTGAAACACCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022916.3-153s1c1
Sequence:CCGGGCAGGAAGCAAGGCAATAGTTCTCGAGAACTATTGCCTTGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022916.3-960s1c1
Sequence:CCGGCGAGATAAGAACTTCAACGCACTCGAGTGCGTTGAAGTTCTTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-1931s1c1
Sequence:CCGGCCCATAGAAGAAACATGGGAACTCGAGTTCCCATGTTTCTTCTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022916.3-2325s1c1
Sequence:CCGGCCTAATCTGCTGAAGAAAGAACTCGAGTTCTTTCTTCAGCAGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022916.3-1379s1c1
Sequence:CCGGGCACATATTGACCTTACACAACTCGAGTTGTGTAAGGTCAATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-1932s1c1
Sequence:CCGGCCATAGAAGAAACATGGGAATCTCGAGATTCCCATGTTTCTTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022916.3-1028s1c1
Sequence:CCGGCGAGGAAAGACACAATGCTAACTCGAGTTAGCATTGTGTCTTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022916
VALIDATED
VPS33A MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 33 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-277s1c1
Sequence:CCGGCGGCAGCTGATGTGAAGAATACTCGAGTATTCTTCACATCAGCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-316s1c1
Sequence:CCGGCCAGGCTAGAGTTGATGGATACTCGAGTATCCATCAACTCTAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022916.3-2209s1c1
Sequence:CCGGGCCATGGTGTTTCACCATGTTCTCGAGAACATGGTGAAACACCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022916.3-153s1c1
Sequence:CCGGGCAGGAAGCAAGGCAATAGTTCTCGAGAACTATTGCCTTGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022916.3-960s1c1
Sequence:CCGGCGAGATAAGAACTTCAACGCACTCGAGTGCGTTGAAGTTCTTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-1931s1c1
Sequence:CCGGCCCATAGAAGAAACATGGGAACTCGAGTTCCCATGTTTCTTCTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022916.3-2325s1c1
Sequence:CCGGCCTAATCTGCTGAAGAAAGAACTCGAGTTCTTTCTTCAGCAGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022916.3-1379s1c1
Sequence:CCGGGCACATATTGACCTTACACAACTCGAGTTGTGTAAGGTCAATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-1932s1c1
Sequence:CCGGCCATAGAAGAAACATGGGAATCTCGAGATTCCCATGTTTCTTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022916.3-1028s1c1
Sequence:CCGGCGAGGAAAGACACAATGCTAACTCGAGTTAGCATTGTGTCTTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022916
VALIDATED
VPS33A MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 33 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-277s1c1
Sequence:CCGGCGGCAGCTGATGTGAAGAATACTCGAGTATTCTTCACATCAGCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-316s1c1
Sequence:CCGGCCAGGCTAGAGTTGATGGATACTCGAGTATCCATCAACTCTAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022916.3-2209s1c1
Sequence:CCGGGCCATGGTGTTTCACCATGTTCTCGAGAACATGGTGAAACACCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022916.3-153s1c1
Sequence:CCGGGCAGGAAGCAAGGCAATAGTTCTCGAGAACTATTGCCTTGCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022916.3-960s1c1
Sequence:CCGGCGAGATAAGAACTTCAACGCACTCGAGTGCGTTGAAGTTCTTATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-1931s1c1
Sequence:CCGGCCCATAGAAGAAACATGGGAACTCGAGTTCCCATGTTTCTTCTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022916.3-2325s1c1
Sequence:CCGGCCTAATCTGCTGAAGAAAGAACTCGAGTTCTTTCTTCAGCAGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022916.3-1379s1c1
Sequence:CCGGGCACATATTGACCTTACACAACTCGAGTTGTGTAAGGTCAATATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_022916.3-1932s1c1
Sequence:CCGGCCATAGAAGAAACATGGGAATCTCGAGATTCCCATGTTTCTTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022916.3-1028s1c1
Sequence:CCGGCGAGGAAAGACACAATGCTAACTCGAGTTAGCATTGTGTCTTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks