EMAIL THIS PAGE TO A FRIEND

VPS33B

vacuolar protein sorting 33 homolog B (yeast)

UniProtKB ID: Q9H267, Q96K14, Q9NRP6, Q9NSF3
Gene ID:
Human(26276) Summary: Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and encodes the human ortholog of rat Vps33b which is homologous to the yeast class C Vps33 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
Mouse(233405) vacuolar protein sorting 33B (yeast)
Rat(64060) vacuolar protein sorting 33 homolog B (yeast)
fruit fly(43077) Vacuolar protein sorting 33B
Horse(100069013) vacuolar protein sorting 33 homolog B (yeast)
domestic cat(101080971) vacuolar protein sorting 33 homolog B (yeast)
dog(479048) vacuolar protein sorting 33 homolog B (yeast)
chicken(425858) vacuolar protein sorting 33 homolog B (yeast)
Zebrafish(541534) vacuolar protein sorting 33B
domestic guinea pig(100725596) vacuolar protein sorting 33 homolog B (yeast)
Domestic Rabbit(100340027) vacuolar protein sorting 33 homolog B (yeast)
naked mole-rat(101714295) vacuolar protein sorting 33 homolog B (yeast)
cow(526538) vacuolar protein sorting 33 homolog B (yeast)
sheep(101105854) vacuolar protein sorting 33 homolog B (yeast)
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018668 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018668 Rosetta Predictions human pricing
NM_022286 Rosetta Predictions rat pricing
NM_178070 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227974 predicted 1490
2 SASI_Hs01_00227976 predicted 584
3 SASI_Hs02_00352180 predicted 2059
4 SASI_Hs02_00352181 predicted 2154
5 SASI_Hs01_00227978 predicted 1081
6 SASI_Hs02_00352182 predicted 2075
7 SASI_Hs01_00227979 predicted 1032
8 SASI_Hs01_00227980 predicted 456
9 SASI_Hs01_00227981 predicted 905
10 SASI_Hs01_00227982 predicted 750
11 SASI_Hs01_00227975 predicted 457
12 SASI_Hs01_00227977 predicted 703
13 SASI_Hs01_00227983 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095117 predicted 1934
2 SASI_Rn01_00095118 predicted 1156
3 SASI_Rn01_00095120 predicted 1221
4 SASI_Rn01_00095121 predicted 566
5 SASI_Rn01_00095122 predicted 1256
6 SASI_Rn01_00095123 predicted 1043
7 SASI_Rn01_00095124 predicted 1172
8 SASI_Rn01_00095125 predicted 677
9 SASI_Rn01_00095126 predicted 584
10 SASI_Rn02_00263104 predicted 707
11 SASI_Rn01_00095119 predicted 2151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130322 predicted 1181
2 SASI_Mm01_00130321 predicted 452
3 SASI_Mm01_00130323 predicted 878
4 SASI_Mm01_00130324 predicted 1060
5 SASI_Mm01_00130325 predicted 1954
6 SASI_Mm01_00130326 predicted 585
7 SASI_Mm01_00130327 predicted 560
8 SASI_Mm01_00130328 predicted 781
9 SASI_Mm01_00130329 predicted 1366
10 SASI_Mm01_00130330 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018668
VALIDATED
VPS33B MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 33 homolog B (yeast)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018668.2-1733s1c1
Sequence:CCGGGCTGCAGGAAAGATTACTGATCTCGAGATCAGTAATCTTTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018668.2-1000s1c1
Sequence:CCGGGCCAGAGATTGGACATATCTTCTCGAGAAGATATGTCCAATCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_018668.2-2218s1c1
Sequence:CCGGCCTGAACACATTCCTCAGTGACTCGAGTCACTGAGGAATGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018668.2-1901s1c1
Sequence:CCGGCGAATCATTGAGCAGGTGCTACTCGAGTAGCACCTGCTCAATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_018668.2-2260s1c1
Sequence:CCGGGCTGCTATAACCAAGTGTCCACTCGAGTGGACACTTGGTTATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_018668.2-1175s1c1
Sequence:CCGGGCCGAGGACAAGGTGTTTAATCTCGAGATTAAACACCTTGTCCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018668.2-1064s1c1
Sequence:CCGGCAAGTGGTTTATGAGGGCCTACTCGAGTAGGCCCTCATAAACCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-2002s21c1
Sequence:GTACCGGGCATTCACAGATATGACTAAGCTCGAGCTTAGTCATATCTGTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-646s21c1
Sequence:GTACCGGCTTGTCAATGCTGACAAATTGCTCGAGCAATTTGTCAGCATTGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018668.3-2269s21c1
Sequence:CCGGTCTGGCACCCAGCTGCTATAACTCGAGTTATAGCAGCTGGGTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-1193s21c1
Sequence:CCGGATGCCGAGGACAAGGTGTTTACTCGAGTAAACACCTTGTCCTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-534s21c1
Sequence:CCGGACACGAAGTAGACAAGCTATACTCGAGTATAGCTTGTCTACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018668
VALIDATED
VPS33B MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 33 homolog B (yeast)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018668.2-1733s1c1
Sequence:CCGGGCTGCAGGAAAGATTACTGATCTCGAGATCAGTAATCTTTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018668.2-1000s1c1
Sequence:CCGGGCCAGAGATTGGACATATCTTCTCGAGAAGATATGTCCAATCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_018668.2-2218s1c1
Sequence:CCGGCCTGAACACATTCCTCAGTGACTCGAGTCACTGAGGAATGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018668.2-1901s1c1
Sequence:CCGGCGAATCATTGAGCAGGTGCTACTCGAGTAGCACCTGCTCAATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_018668.2-2260s1c1
Sequence:CCGGGCTGCTATAACCAAGTGTCCACTCGAGTGGACACTTGGTTATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_018668.2-1175s1c1
Sequence:CCGGGCCGAGGACAAGGTGTTTAATCTCGAGATTAAACACCTTGTCCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018668.2-1064s1c1
Sequence:CCGGCAAGTGGTTTATGAGGGCCTACTCGAGTAGGCCCTCATAAACCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-2002s21c1
Sequence:GTACCGGGCATTCACAGATATGACTAAGCTCGAGCTTAGTCATATCTGTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-646s21c1
Sequence:GTACCGGCTTGTCAATGCTGACAAATTGCTCGAGCAATTTGTCAGCATTGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018668.3-2269s21c1
Sequence:CCGGTCTGGCACCCAGCTGCTATAACTCGAGTTATAGCAGCTGGGTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-1193s21c1
Sequence:CCGGATGCCGAGGACAAGGTGTTTACTCGAGTAAACACCTTGTCCTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-534s21c1
Sequence:CCGGACACGAAGTAGACAAGCTATACTCGAGTATAGCTTGTCTACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018668
VALIDATED
VPS33B MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 33 homolog B (yeast)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018668.2-1733s1c1
Sequence:CCGGGCTGCAGGAAAGATTACTGATCTCGAGATCAGTAATCTTTCCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018668.2-1000s1c1
Sequence:CCGGGCCAGAGATTGGACATATCTTCTCGAGAAGATATGTCCAATCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_018668.2-2218s1c1
Sequence:CCGGCCTGAACACATTCCTCAGTGACTCGAGTCACTGAGGAATGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018668.2-1901s1c1
Sequence:CCGGCGAATCATTGAGCAGGTGCTACTCGAGTAGCACCTGCTCAATGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_018668.2-2260s1c1
Sequence:CCGGGCTGCTATAACCAAGTGTCCACTCGAGTGGACACTTGGTTATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_018668.2-1175s1c1
Sequence:CCGGGCCGAGGACAAGGTGTTTAATCTCGAGATTAAACACCTTGTCCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018668.2-1064s1c1
Sequence:CCGGCAAGTGGTTTATGAGGGCCTACTCGAGTAGGCCCTCATAAACCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-2002s21c1
Sequence:GTACCGGGCATTCACAGATATGACTAAGCTCGAGCTTAGTCATATCTGTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-646s21c1
Sequence:GTACCGGCTTGTCAATGCTGACAAATTGCTCGAGCAATTTGTCAGCATTGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018668.3-2269s21c1
Sequence:CCGGTCTGGCACCCAGCTGCTATAACTCGAGTTATAGCAGCTGGGTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-1193s21c1
Sequence:CCGGATGCCGAGGACAAGGTGTTTACTCGAGTAAACACCTTGTCCTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018668.3-534s21c1
Sequence:CCGGACACGAAGTAGACAAGCTATACTCGAGTATAGCTTGTCTACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178070
VALIDATED
VPS33B MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 33 homolog B (yeast)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178070.2-472s1c1
Sequence:CCGGCCCTTTGGATCGAAATGCTAACTCGAGTTAGCATTTCGATCCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178070.2-998s1c1
Sequence:CCGGCCAGAGATTGGACACATCTTTCTCGAGAAAGATGTGTCCAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178070.2-1199s1c1
Sequence:CCGGCGCAATGAGCACTTCTCCAATCTCGAGATTGGAGAAGTGCTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178070.2-1957s1c1
Sequence:CCGGGCTGCTAAACTGCAGTGAGTTCTCGAGAACTCACTGCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178070.2-2353s1c1
Sequence:CCGGGCTGGGAACTTTGGAACTAATCTCGAGATTAGTTCCAAAGTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-789s21c1
Sequence:GTACCGGAGCATGGAACTGCCAGAATTTCTCGAGAAATTCTGGCAGTTCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178070.4-2192s21c1
Sequence:CCGGTGGCCAGTGCTGAAGTATTTCCTCGAGGAAATACTTCAGCACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-480s21c1
Sequence:CCGGCGAATTGCTAACGTCTCTATCCTCGAGGATAGAGACGTTAGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178070.4-709s21c1
Sequence:CCGGTTGAGGAAGAGGGAGTCTATGCTCGAGCATAGACTCCCTCTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-1245s21c1
Sequence:CCGGCGGAACTTGCAGGCCCAATATCTCGAGATATTGGGCCTGCAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-1271s21c1
Sequence:CCGGCCGGAGAGGCATGGACATAAACTCGAGTTTATGTCCATGCCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-921s21c1
Sequence:GTACCGGAGATGTGCAAAGATGTCATATCTCGAGATATGACATCTTTGCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178070.4-2387s21c1
Sequence:GTACCGGTACTCAGAGCTGGGAACTTTGCTCGAGCAAAGTTCCCAGCTCTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178070
VALIDATED
VPS33B MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 33 homolog B (yeast)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178070.2-472s1c1
Sequence:CCGGCCCTTTGGATCGAAATGCTAACTCGAGTTAGCATTTCGATCCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178070.2-998s1c1
Sequence:CCGGCCAGAGATTGGACACATCTTTCTCGAGAAAGATGTGTCCAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178070.2-1199s1c1
Sequence:CCGGCGCAATGAGCACTTCTCCAATCTCGAGATTGGAGAAGTGCTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178070.2-1957s1c1
Sequence:CCGGGCTGCTAAACTGCAGTGAGTTCTCGAGAACTCACTGCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178070.2-2353s1c1
Sequence:CCGGGCTGGGAACTTTGGAACTAATCTCGAGATTAGTTCCAAAGTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-789s21c1
Sequence:GTACCGGAGCATGGAACTGCCAGAATTTCTCGAGAAATTCTGGCAGTTCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178070.4-2192s21c1
Sequence:CCGGTGGCCAGTGCTGAAGTATTTCCTCGAGGAAATACTTCAGCACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-480s21c1
Sequence:CCGGCGAATTGCTAACGTCTCTATCCTCGAGGATAGAGACGTTAGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178070.4-709s21c1
Sequence:CCGGTTGAGGAAGAGGGAGTCTATGCTCGAGCATAGACTCCCTCTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-1245s21c1
Sequence:CCGGCGGAACTTGCAGGCCCAATATCTCGAGATATTGGGCCTGCAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-1271s21c1
Sequence:CCGGCCGGAGAGGCATGGACATAAACTCGAGTTTATGTCCATGCCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-921s21c1
Sequence:GTACCGGAGATGTGCAAAGATGTCATATCTCGAGATATGACATCTTTGCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178070.4-2387s21c1
Sequence:GTACCGGTACTCAGAGCTGGGAACTTTGCTCGAGCAAAGTTCCCAGCTCTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178070
VALIDATED
VPS33B MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 33 homolog B (yeast)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178070.2-472s1c1
Sequence:CCGGCCCTTTGGATCGAAATGCTAACTCGAGTTAGCATTTCGATCCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178070.2-998s1c1
Sequence:CCGGCCAGAGATTGGACACATCTTTCTCGAGAAAGATGTGTCCAATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178070.2-1199s1c1
Sequence:CCGGCGCAATGAGCACTTCTCCAATCTCGAGATTGGAGAAGTGCTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178070.2-1957s1c1
Sequence:CCGGGCTGCTAAACTGCAGTGAGTTCTCGAGAACTCACTGCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178070.2-2353s1c1
Sequence:CCGGGCTGGGAACTTTGGAACTAATCTCGAGATTAGTTCCAAAGTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-789s21c1
Sequence:GTACCGGAGCATGGAACTGCCAGAATTTCTCGAGAAATTCTGGCAGTTCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178070.4-2192s21c1
Sequence:CCGGTGGCCAGTGCTGAAGTATTTCCTCGAGGAAATACTTCAGCACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-480s21c1
Sequence:CCGGCGAATTGCTAACGTCTCTATCCTCGAGGATAGAGACGTTAGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178070.4-709s21c1
Sequence:CCGGTTGAGGAAGAGGGAGTCTATGCTCGAGCATAGACTCCCTCTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-1245s21c1
Sequence:CCGGCGGAACTTGCAGGCCCAATATCTCGAGATATTGGGCCTGCAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-1271s21c1
Sequence:CCGGCCGGAGAGGCATGGACATAAACTCGAGTTTATGTCCATGCCTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178070.4-921s21c1
Sequence:GTACCGGAGATGTGCAAAGATGTCATATCTCGAGATATGACATCTTTGCACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178070.4-2387s21c1
Sequence:GTACCGGTACTCAGAGCTGGGAACTTTGCTCGAGCAAAGTTCCCAGCTCTGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks