EMAIL THIS PAGE TO A FRIEND

VPS35

vacuolar protein sorting 35 homolog (S. cerevisiae)

Synonyms: MEM3 PARK17
Gene ID:
Human(55737) Summary: This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. [provided by RefSeq, Jul 2008]
Mouse(65114) vacuolar protein sorting 35
Rat(25479) vacuolar protein sorting 35 homolog (S. cerevisiae)
fruit fly(37536) Vacuolar protein sorting 35
Zebrafish(561697) vacuolar protein sorting 35 (yeast)
chicken(415750) vacuolar protein sorting 35 homolog (S. cerevisiae)
dog(475346) vacuolar protein sorting 35 homolog (S. cerevisiae)
Horse(100056512) vacuolar protein sorting 35 homolog (S. cerevisiae)
domestic cat(101087369) vacuolar protein sorting 35 homolog (S. cerevisiae)
cow(521864) vacuolar protein sorting 35 homolog (S. cerevisiae)
sheep(101109294) vacuolar protein sorting 35 homolog (S. cerevisiae)
naked mole-rat(101697141) vacuolar protein sorting 35 homolog (S. cerevisiae)
Domestic Rabbit(100351202) vacuolar protein sorting 35 homolog (S. cerevisiae)
domestic guinea pig(100725468) vacuolar protein sorting 35 homolog (S. cerevisiae)
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018206 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022997 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022997 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022997 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075291 MISSION® esiRNA esiRNA human VPS35 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018206 Rosetta Predictions human pricing
NM_001105718 Rosetta Predictions rat pricing
NM_022997 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153195 predicted 787
2 SASI_Hs01_00153196 predicted 955
3 SASI_Hs01_00153197 predicted 260
4 SASI_Hs01_00153198 predicted 2178
5 SASI_Hs01_00153199 predicted 696
6 SASI_Hs01_00153201 predicted 1792
7 SASI_Hs01_00153202 predicted 1655
8 SASI_Hs01_00153203 predicted 553
9 SASI_Hs01_00153204 predicted 428
10 SASI_Hs02_00351507 predicted 603
11 SASI_Hs01_00153200 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211846 predicted 2459
2 SASI_Rn02_00211847 predicted 2310
3 SASI_Rn02_00211848 predicted 2070
4 SASI_Rn02_00211849 predicted 1860
5 SASI_Rn02_00211850 predicted 1968
6 SASI_Rn02_00211851 predicted 2236
7 SASI_Rn02_00211852 predicted 2461
8 SASI_Rn02_00211853 predicted 2283
9 SASI_Rn02_00211854 predicted 2192
10 SASI_Rn02_00211855 predicted 1931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091208 predicted 2285
2 SASI_Mm02_00326728 predicted 1361
3 SASI_Mm01_00091209 predicted 731
4 SASI_Mm01_00091210 predicted 224
5 SASI_Mm01_00091211 predicted 631
6 SASI_Mm01_00091212 predicted 749
7 SASI_Mm01_00091213 predicted 550
8 SASI_Mm01_00091215 predicted 1915
9 SASI_Mm01_00091216 predicted 1166
10 SASI_Mm01_00091217 predicted 2172
11 SASI_Mm01_00091214 predicted 1763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018206
VALIDATED
VPS35 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 35 homolog (S. cerevisiae)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-272s21c1
Sequence:GTACCGGTATCACCAAAGAGTTACTATGCTCGAGCATAGTAACTCTTTGGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-1364s21c1
Sequence:GTACCGGACCCACTCTTTGAGTACTTTGCTCGAGCAAAGTACTCAAAGAGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-924s21c1
Sequence:CCGGCCTCCAGACTTTGAATCCTTTCTCGAGAAAGGATTCAAAGTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-2642s21c1
Sequence:CCGGACTCACCTTCAGGACCTTAATCTCGAGATTAAGGTCCTGAAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-2376s21c1
Sequence:CCGGCAGTGAAGAAACAGAGCAGATCTCGAGATCTGCTCTGTTTCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-373s21c1
Sequence:CCGGGCAGATCTCTACGAACTTGTACTCGAGTACAAGTTCGTAGAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-534s21c1
Sequence:GTACCGGGGGTCTGTTTCTTCGAAATTACTCGAGTAATTTCGAAGAAACAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-980s21c1
Sequence:GTACCGGATGTGAAGAACATAATCATTGCTCGAGCAATGATTATGTTCTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-1047s21c1
Sequence:GTACCGGTGGAATCCCAGCGGATATTAACTCGAGTTAATATCCGCTGGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-2324s1c1
Sequence:CCGGCAGTGAAGAAACAGAGCAGATCTCGAGATCTGCTCTGTTTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-1412s1c1
Sequence:CCGGCCAGGTGGATTCCATAATGAACTCGAGTTCATTATGGAATCCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018206.3-1893s1c1
Sequence:CCGGGATGAAATCAGCGATTCCAAACTCGAGTTTGGAATCGCTGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018206.3-292s1c1
Sequence:CCGGCAGATGAGTTTGCTAAAGGAACTCGAGTTCCTTTAGCAAACTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-321s1c1
Sequence:CCGGGCAGATCTCTACGAACTTGTACTCGAGTACAAGTTCGTAGAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-1742s1c1
Sequence:CCGGCCAGACTATCAGTGCTTTGATCTCGAGATCAAAGCACTGATAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-872s1c1
Sequence:CCGGCCTCCAGACTTTGAATCCTTTCTCGAGAAAGGATTCAAAGTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018206
VALIDATED
VPS35 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 35 homolog (S. cerevisiae)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-272s21c1
Sequence:GTACCGGTATCACCAAAGAGTTACTATGCTCGAGCATAGTAACTCTTTGGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-1364s21c1
Sequence:GTACCGGACCCACTCTTTGAGTACTTTGCTCGAGCAAAGTACTCAAAGAGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-924s21c1
Sequence:CCGGCCTCCAGACTTTGAATCCTTTCTCGAGAAAGGATTCAAAGTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-2642s21c1
Sequence:CCGGACTCACCTTCAGGACCTTAATCTCGAGATTAAGGTCCTGAAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-2376s21c1
Sequence:CCGGCAGTGAAGAAACAGAGCAGATCTCGAGATCTGCTCTGTTTCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-373s21c1
Sequence:CCGGGCAGATCTCTACGAACTTGTACTCGAGTACAAGTTCGTAGAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-534s21c1
Sequence:GTACCGGGGGTCTGTTTCTTCGAAATTACTCGAGTAATTTCGAAGAAACAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-980s21c1
Sequence:GTACCGGATGTGAAGAACATAATCATTGCTCGAGCAATGATTATGTTCTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-1047s21c1
Sequence:GTACCGGTGGAATCCCAGCGGATATTAACTCGAGTTAATATCCGCTGGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-2324s1c1
Sequence:CCGGCAGTGAAGAAACAGAGCAGATCTCGAGATCTGCTCTGTTTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-1412s1c1
Sequence:CCGGCCAGGTGGATTCCATAATGAACTCGAGTTCATTATGGAATCCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018206.3-1893s1c1
Sequence:CCGGGATGAAATCAGCGATTCCAAACTCGAGTTTGGAATCGCTGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018206.3-292s1c1
Sequence:CCGGCAGATGAGTTTGCTAAAGGAACTCGAGTTCCTTTAGCAAACTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-321s1c1
Sequence:CCGGGCAGATCTCTACGAACTTGTACTCGAGTACAAGTTCGTAGAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-1742s1c1
Sequence:CCGGCCAGACTATCAGTGCTTTGATCTCGAGATCAAAGCACTGATAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-872s1c1
Sequence:CCGGCCTCCAGACTTTGAATCCTTTCTCGAGAAAGGATTCAAAGTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018206
VALIDATED
VPS35 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 35 homolog (S. cerevisiae)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-272s21c1
Sequence:GTACCGGTATCACCAAAGAGTTACTATGCTCGAGCATAGTAACTCTTTGGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-1364s21c1
Sequence:GTACCGGACCCACTCTTTGAGTACTTTGCTCGAGCAAAGTACTCAAAGAGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-924s21c1
Sequence:CCGGCCTCCAGACTTTGAATCCTTTCTCGAGAAAGGATTCAAAGTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-2642s21c1
Sequence:CCGGACTCACCTTCAGGACCTTAATCTCGAGATTAAGGTCCTGAAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-2376s21c1
Sequence:CCGGCAGTGAAGAAACAGAGCAGATCTCGAGATCTGCTCTGTTTCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018206.4-373s21c1
Sequence:CCGGGCAGATCTCTACGAACTTGTACTCGAGTACAAGTTCGTAGAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-534s21c1
Sequence:GTACCGGGGGTCTGTTTCTTCGAAATTACTCGAGTAATTTCGAAGAAACAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-980s21c1
Sequence:GTACCGGATGTGAAGAACATAATCATTGCTCGAGCAATGATTATGTTCTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018206.4-1047s21c1
Sequence:GTACCGGTGGAATCCCAGCGGATATTAACTCGAGTTAATATCCGCTGGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-2324s1c1
Sequence:CCGGCAGTGAAGAAACAGAGCAGATCTCGAGATCTGCTCTGTTTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-1412s1c1
Sequence:CCGGCCAGGTGGATTCCATAATGAACTCGAGTTCATTATGGAATCCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018206.3-1893s1c1
Sequence:CCGGGATGAAATCAGCGATTCCAAACTCGAGTTTGGAATCGCTGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018206.3-292s1c1
Sequence:CCGGCAGATGAGTTTGCTAAAGGAACTCGAGTTCCTTTAGCAAACTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-321s1c1
Sequence:CCGGGCAGATCTCTACGAACTTGTACTCGAGTACAAGTTCGTAGAGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-1742s1c1
Sequence:CCGGCCAGACTATCAGTGCTTTGATCTCGAGATCAAAGCACTGATAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018206.3-872s1c1
Sequence:CCGGCCTCCAGACTTTGAATCCTTTCTCGAGAAAGGATTCAAAGTCTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022997
VALIDATED
VPS35 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 35 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-1185s21c1
Sequence:GTACCGGAGCTTAACCTTGAACATATTGCTCGAGCAATATGTTCAAGGTTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022997.4-2685s21c1
Sequence:CCGGCCACTTATTCTGGCTACTAATCTCGAGATTAGTAGCCAGAATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-1493s21c1
Sequence:CCGGGCTGATGAACAGAGCCTTGTTCTCGAGAACAAGGCTCTGTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-1133s21c1
Sequence:CCGGCGTGTGGACTACGTCGATAAACTCGAGTTTATCGACGTAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-211s21c1
Sequence:CCGGGCTGTCACCAAAGAGTTACTACTCGAGTAGTAACTCTTTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-822s21c1
Sequence:GTACCGGATCTCATGGAGTGCATCATTCCTCGAGGAATGATGCACTCCATGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-2710s1c1
Sequence:CCGGCCACTTATTCTGGCTACTAATCTCGAGATTAGTAGCCAGAATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-1158s1c1
Sequence:CCGGCGTGTGGACTACGTCGATAAACTCGAGTTTATCGACGTAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-2328s1c1
Sequence:CCGGCCAAATCTTGAGTCCAGTGAACTCGAGTTCACTGGACTCAAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-1518s1c1
Sequence:CCGGGCTGATGAACAGAGCCTTGTTCTCGAGAACAAGGCTCTGTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-236s1c1
Sequence:CCGGGCTGTCACCAAAGAGTTACTACTCGAGTAGTAACTCTTTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022997
VALIDATED
VPS35 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 35 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-1185s21c1
Sequence:GTACCGGAGCTTAACCTTGAACATATTGCTCGAGCAATATGTTCAAGGTTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022997.4-2685s21c1
Sequence:CCGGCCACTTATTCTGGCTACTAATCTCGAGATTAGTAGCCAGAATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-1493s21c1
Sequence:CCGGGCTGATGAACAGAGCCTTGTTCTCGAGAACAAGGCTCTGTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-1133s21c1
Sequence:CCGGCGTGTGGACTACGTCGATAAACTCGAGTTTATCGACGTAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-211s21c1
Sequence:CCGGGCTGTCACCAAAGAGTTACTACTCGAGTAGTAACTCTTTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-822s21c1
Sequence:GTACCGGATCTCATGGAGTGCATCATTCCTCGAGGAATGATGCACTCCATGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-2710s1c1
Sequence:CCGGCCACTTATTCTGGCTACTAATCTCGAGATTAGTAGCCAGAATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-1158s1c1
Sequence:CCGGCGTGTGGACTACGTCGATAAACTCGAGTTTATCGACGTAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-2328s1c1
Sequence:CCGGCCAAATCTTGAGTCCAGTGAACTCGAGTTCACTGGACTCAAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-1518s1c1
Sequence:CCGGGCTGATGAACAGAGCCTTGTTCTCGAGAACAAGGCTCTGTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-236s1c1
Sequence:CCGGGCTGTCACCAAAGAGTTACTACTCGAGTAGTAACTCTTTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022997
VALIDATED
VPS35 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 35 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-1185s21c1
Sequence:GTACCGGAGCTTAACCTTGAACATATTGCTCGAGCAATATGTTCAAGGTTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022997.4-2685s21c1
Sequence:CCGGCCACTTATTCTGGCTACTAATCTCGAGATTAGTAGCCAGAATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-1493s21c1
Sequence:CCGGGCTGATGAACAGAGCCTTGTTCTCGAGAACAAGGCTCTGTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-1133s21c1
Sequence:CCGGCGTGTGGACTACGTCGATAAACTCGAGTTTATCGACGTAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-211s21c1
Sequence:CCGGGCTGTCACCAAAGAGTTACTACTCGAGTAGTAACTCTTTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022997.4-822s21c1
Sequence:GTACCGGATCTCATGGAGTGCATCATTCCTCGAGGAATGATGCACTCCATGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-2710s1c1
Sequence:CCGGCCACTTATTCTGGCTACTAATCTCGAGATTAGTAGCCAGAATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-1158s1c1
Sequence:CCGGCGTGTGGACTACGTCGATAAACTCGAGTTTATCGACGTAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-2328s1c1
Sequence:CCGGCCAAATCTTGAGTCCAGTGAACTCGAGTTCACTGGACTCAAGATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-1518s1c1
Sequence:CCGGGCTGATGAACAGAGCCTTGTTCTCGAGAACAAGGCTCTGTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_022997.2-236s1c1
Sequence:CCGGGCTGTCACCAAAGAGTTACTACTCGAGTAGTAACTCTTTGGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks