EMAIL THIS PAGE TO A FRIEND

VPS36

vacuolar protein sorting 36 homolog (S. cerevisiae)

Synonyms: C13orf9 EAP45
Gene ID:
Human(51028) Summary: VPS36, VPS22 (SNF8; MIM 610904), and VPS25 (MIM 610907) form ESCRT-II (endosomal sorting complex required for transport II), a complex involved in endocytosis of ubiquitinated membrane proteins. VPS36, VPS22, and VPS25 are also associated in a multiprotein complex with RNA polymerase II elongation factor (ELL; MIM 600284) (Slagsvold et al., 2005 [PubMed 15755741]
Mouse(70160) vacuolar protein sorting 36 (yeast)
Rat(290851) vacuolar protein sorting 36 homolog (S. cerevisiae)
fruit fly(39523) Vacuolar protein sorting 36
Zebrafish(335810) vacuolar protein sorting 36 homolog (S. cerevisiae)
domestic cat(101097120) vacuolar protein sorting 36 homolog (S. cerevisiae)
Horse(100147348) vacuolar protein sorting 36 homolog (S. cerevisiae)
dog(477292) vacuolar protein sorting 36 homolog (S. cerevisiae)
chicken(418883) vacuolar protein sorting 36 homolog (S. cerevisiae)
domestic guinea pig(100722024) vacuolar protein sorting 36 homolog (S. cerevisiae)
Domestic Rabbit(100340347) vacuolar protein sorting 36 homolog (S. cerevisiae)
naked mole-rat(101709114) vacuolar protein sorting 36 homolog (S. cerevisiae)
cow(511223) vacuolar protein sorting 36 homolog (S. cerevisiae)
sheep(101121612) vacuolar protein sorting 36 homolog (S. cerevisiae)
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016075 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027338 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027338 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027338 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016075 Rosetta Predictions human pricing
NM_001106092 Rosetta Predictions rat pricing
NM_027338 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158584 predicted 1248
2 SASI_Hs01_00158586 predicted 904
3 SASI_Hs01_00158587 predicted 1244
4 SASI_Hs01_00158588 predicted 782
5 SASI_Hs01_00158589 predicted 255
6 SASI_Hs01_00158590 predicted 1219
7 SASI_Hs01_00158592 predicted 1105
8 SASI_Hs01_00158593 predicted 1413
9 SASI_Hs02_00348818 predicted 1276
10 SASI_Hs02_00348819 predicted 1427
11 SASI_Hs01_00158585 predicted 1173
12 SASI_Hs01_00158591 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215552 predicted 898
2 SASI_Rn02_00215553 predicted 498
3 SASI_Rn02_00215554 predicted 313
4 SASI_Rn02_00215555 predicted 635
5 SASI_Rn02_00215556 predicted 593
6 SASI_Rn02_00215557 predicted 985
7 SASI_Rn02_00215558 predicted 716
8 SASI_Rn02_00215559 predicted 551
9 SASI_Rn02_00215560 predicted 1004
10 SASI_Rn02_00215561 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331971 predicted 1047
2 SASI_Mm01_00159672 predicted 748
3 SASI_Mm01_00159673 predicted 1022
4 SASI_Mm01_00159674 predicted 926
5 SASI_Mm01_00159675 predicted 805
6 SASI_Mm01_00159676 predicted 804
7 SASI_Mm01_00159677 predicted 754
8 SASI_Mm01_00159678 predicted 882
9 SASI_Mm01_00159679 predicted 901
10 SASI_Mm01_00159680 predicted 1012
11 SASI_Mm01_00159671 predicted 943
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016075
VALIDATED
VPS36 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 36 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-302s1c1
Sequence:CCGGGAGTAGTAAGAACTCCTACATCTCGAGATGTAGGAGTTCTTACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016075.1-550s1c1
Sequence:CCGGGCAAACTAATGATCAAGGCTACTCGAGTAGCCTTGATCATTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-932s1c1
Sequence:CCGGCGTCATGGTAATTGAGCTTCACTCGAGTGAAGCTCAATTACCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-639s1c1
Sequence:CCGGGATGAGACCATCAGGTTTAAACTCGAGTTTAAACCTGATGGTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-373s1c1
Sequence:CCGGCAGAGGAAATGACACAAAGAACTCGAGTTCTTTGTGTCATTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-320s21c1
Sequence:GTACCGGGGCCCATTCCAGAGTAGTAAGCTCGAGCTTACTACTCTGGAATGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-1275s21c1
Sequence:GTACCGGCCCGATCAATTGAGAATTTATCTCGAGATAAATTCTCAATTGATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-669s21c1
Sequence:GTACCGGATGAGACCATCAGGTTTAAATCTCGAGATTTAAACCTGATGGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-294s21c1
Sequence:GTACCGGACCCAGCTCCTCCTAACAAAGCTCGAGCTTTGTTAGGAGGAGCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016075
VALIDATED
VPS36 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 36 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-302s1c1
Sequence:CCGGGAGTAGTAAGAACTCCTACATCTCGAGATGTAGGAGTTCTTACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016075.1-550s1c1
Sequence:CCGGGCAAACTAATGATCAAGGCTACTCGAGTAGCCTTGATCATTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-932s1c1
Sequence:CCGGCGTCATGGTAATTGAGCTTCACTCGAGTGAAGCTCAATTACCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-639s1c1
Sequence:CCGGGATGAGACCATCAGGTTTAAACTCGAGTTTAAACCTGATGGTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-373s1c1
Sequence:CCGGCAGAGGAAATGACACAAAGAACTCGAGTTCTTTGTGTCATTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-320s21c1
Sequence:GTACCGGGGCCCATTCCAGAGTAGTAAGCTCGAGCTTACTACTCTGGAATGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-1275s21c1
Sequence:GTACCGGCCCGATCAATTGAGAATTTATCTCGAGATAAATTCTCAATTGATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-669s21c1
Sequence:GTACCGGATGAGACCATCAGGTTTAAATCTCGAGATTTAAACCTGATGGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-294s21c1
Sequence:GTACCGGACCCAGCTCCTCCTAACAAAGCTCGAGCTTTGTTAGGAGGAGCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016075
VALIDATED
VPS36 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 36 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-302s1c1
Sequence:CCGGGAGTAGTAAGAACTCCTACATCTCGAGATGTAGGAGTTCTTACTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016075.1-550s1c1
Sequence:CCGGGCAAACTAATGATCAAGGCTACTCGAGTAGCCTTGATCATTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-932s1c1
Sequence:CCGGCGTCATGGTAATTGAGCTTCACTCGAGTGAAGCTCAATTACCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-639s1c1
Sequence:CCGGGATGAGACCATCAGGTTTAAACTCGAGTTTAAACCTGATGGTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016075.1-373s1c1
Sequence:CCGGCAGAGGAAATGACACAAAGAACTCGAGTTCTTTGTGTCATTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-320s21c1
Sequence:GTACCGGGGCCCATTCCAGAGTAGTAAGCTCGAGCTTACTACTCTGGAATGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-1275s21c1
Sequence:GTACCGGCCCGATCAATTGAGAATTTATCTCGAGATAAATTCTCAATTGATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-669s21c1
Sequence:GTACCGGATGAGACCATCAGGTTTAAATCTCGAGATTTAAACCTGATGGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016075.2-294s21c1
Sequence:GTACCGGACCCAGCTCCTCCTAACAAAGCTCGAGCTTTGTTAGGAGGAGCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027338
VALIDATED
VPS36 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 36 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027338.1-674s1c1
Sequence:CCGGGCTGAGTATGGGAATAGCCAACTCGAGTTGGCTATTCCCATACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027338.1-556s1c1
Sequence:CCGGGCAAGCTGATGATTAAGGCTACTCGAGTAGCCTTAATCATCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027338.1-167s1c1
Sequence:CCGGGAAGAATAATGAGTGCTGCATCTCGAGATGCAGCACTCATTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027338.1-422s1c1
Sequence:CCGGCCAGTCACTACAAACAAATAACTCGAGTTATTTGTTTGTAGTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-556s21c1
Sequence:CCGGGCAAGCTGATGATTAAGGCTACTCGAGTAGCCTTAATCATCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027338.1-136s21c1
Sequence:CCGGTTAGTACACACCGGCTGATTTCTCGAGAAATCAGCCGGTGTGTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-593s21c1
Sequence:CCGGATCCAAATCAATCGCTAATAACTCGAGTTATTAGCGATTGATTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-469s21c1
Sequence:CCGGCTGTTGGAATTGTAGGTATTGCTCGAGCAATACCTACAATTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-422s21c1
Sequence:CCGGCCAGTCACTACAAACAAATAACTCGAGTTATTTGTTTGTAGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027338.1-884s21c1
Sequence:GTACCGGCAAGATGCTGGAAGCGCTAAACTCGAGTTTAGCGCTTCCAGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027338.1-749s21c1
Sequence:GTACCGGCAAACAGCTGGCTGGAATATTCTCGAGAATATTCCAGCCAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027338
VALIDATED
VPS36 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 36 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027338.1-674s1c1
Sequence:CCGGGCTGAGTATGGGAATAGCCAACTCGAGTTGGCTATTCCCATACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027338.1-556s1c1
Sequence:CCGGGCAAGCTGATGATTAAGGCTACTCGAGTAGCCTTAATCATCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027338.1-167s1c1
Sequence:CCGGGAAGAATAATGAGTGCTGCATCTCGAGATGCAGCACTCATTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027338.1-422s1c1
Sequence:CCGGCCAGTCACTACAAACAAATAACTCGAGTTATTTGTTTGTAGTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-556s21c1
Sequence:CCGGGCAAGCTGATGATTAAGGCTACTCGAGTAGCCTTAATCATCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027338.1-136s21c1
Sequence:CCGGTTAGTACACACCGGCTGATTTCTCGAGAAATCAGCCGGTGTGTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-593s21c1
Sequence:CCGGATCCAAATCAATCGCTAATAACTCGAGTTATTAGCGATTGATTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-469s21c1
Sequence:CCGGCTGTTGGAATTGTAGGTATTGCTCGAGCAATACCTACAATTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-422s21c1
Sequence:CCGGCCAGTCACTACAAACAAATAACTCGAGTTATTTGTTTGTAGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027338.1-884s21c1
Sequence:GTACCGGCAAGATGCTGGAAGCGCTAAACTCGAGTTTAGCGCTTCCAGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027338.1-749s21c1
Sequence:GTACCGGCAAACAGCTGGCTGGAATATTCTCGAGAATATTCCAGCCAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027338
VALIDATED
VPS36 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 36 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027338.1-674s1c1
Sequence:CCGGGCTGAGTATGGGAATAGCCAACTCGAGTTGGCTATTCCCATACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027338.1-556s1c1
Sequence:CCGGGCAAGCTGATGATTAAGGCTACTCGAGTAGCCTTAATCATCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027338.1-167s1c1
Sequence:CCGGGAAGAATAATGAGTGCTGCATCTCGAGATGCAGCACTCATTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027338.1-422s1c1
Sequence:CCGGCCAGTCACTACAAACAAATAACTCGAGTTATTTGTTTGTAGTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-556s21c1
Sequence:CCGGGCAAGCTGATGATTAAGGCTACTCGAGTAGCCTTAATCATCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027338.1-136s21c1
Sequence:CCGGTTAGTACACACCGGCTGATTTCTCGAGAAATCAGCCGGTGTGTACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-593s21c1
Sequence:CCGGATCCAAATCAATCGCTAATAACTCGAGTTATTAGCGATTGATTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-469s21c1
Sequence:CCGGCTGTTGGAATTGTAGGTATTGCTCGAGCAATACCTACAATTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027338.1-422s21c1
Sequence:CCGGCCAGTCACTACAAACAAATAACTCGAGTTATTTGTTTGTAGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027338.1-884s21c1
Sequence:GTACCGGCAAGATGCTGGAAGCGCTAAACTCGAGTTTAGCGCTTCCAGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027338.1-749s21c1
Sequence:GTACCGGCAAACAGCTGGCTGGAATATTCTCGAGAATATTCCAGCCAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks