EMAIL THIS PAGE TO A FRIEND

VPS37A

vacuolar protein sorting 37 homolog A (S. cerevisiae)

Synonyms: HCRP1 PQBP2 SPG53
UniProtKB ID: Q8NEZ2, Q336D5, Q6NW27, Q8N3D7, Q8TBL7, Q96DL9
Gene ID:
Human(137492) Summary: This gene belongs to the VPS37 family, and encodes a component of the ESCRT-I (endosomal sorting complex required for transport I) protein complex, required for the sorting of ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies. Expression of this gene is downregulated in hepatocellular carcinoma, and mutations in this gene are associated with autosomal recessive spastic paraplegia-53. A related pseudogene has been identified on chromosome 5. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(52348) vacuolar protein sorting 37A (yeast)
Rat(290775) vacuolar protein sorting 37 homolog A (S. cerevisiae)
Zebrafish(336368) vacuolar protein sorting 37A
Horse(100050168) vacuolar protein sorting 37 homolog A (S. cerevisiae)
domestic cat(101083260) vacuolar protein sorting 37 homolog A (S. cerevisiae)
dog(475611) vacuolar protein sorting 37 homolog A (S. cerevisiae)
chicken(422732) vacuolar protein sorting 37 homolog A (S. cerevisiae)
cow(513985) vacuolar protein sorting 37 homolog A (S. cerevisiae)
sheep(101120049) vacuolar protein sorting 37 homolog A (S. cerevisiae)
naked mole-rat(101700435) vacuolar protein sorting 37 homolog A (S. cerevisiae)
domestic guinea pig(100732379) vacuolar protein sorting 37 homolog A (S. cerevisiae)
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152415 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152415 Rosetta Predictions human pricing
NM_001024867 Rosetta Predictions rat pricing
NM_033560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366124 predicted 1019
2 SASI_Hs01_00043720 predicted 1438
3 SASI_Hs02_00366125 predicted 1474
4 SASI_Hs01_00043722 predicted 1214
5 SASI_Hs01_00043723 predicted 774
6 SASI_Hs02_00366126 predicted 387
7 SASI_Hs01_00043726 predicted 408
8 SASI_Hs01_00043727 predicted 714
9 SASI_Hs01_00043728 predicted 1274
10 SASI_Hs01_00043729 predicted 444
11 SASI_Hs01_00043721 predicted 1337
12 SASI_Hs01_00043724 predicted 1073
13 SASI_Hs01_00043725 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083892 predicted 909
2 SASI_Rn01_00083893 predicted 864
3 SASI_Rn01_00083894 predicted 1277
4 SASI_Rn01_00083895 predicted 1473
5 SASI_Rn01_00083896 predicted 1286
6 SASI_Rn01_00083897 predicted 405
7 SASI_Rn01_00083898 predicted 981
8 SASI_Rn01_00083899 predicted 1136
9 SASI_Rn01_00083900 predicted 1195
10 SASI_Rn01_00083901 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182751 predicted 1520
2 SASI_Mm01_00182752 predicted 929
3 SASI_Mm01_00182753 predicted 999
4 SASI_Mm01_00182754 predicted 1075
5 SASI_Mm01_00182755 predicted 1259
6 SASI_Mm01_00182756 predicted 1602
7 SASI_Mm01_00182757 predicted 952
8 SASI_Mm01_00182758 predicted 580
9 SASI_Mm01_00182759 predicted 496
10 SASI_Mm01_00182760 predicted 1271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152415
VALIDATED
VPS37A MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 37 homolog A (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-1335s21c1
Sequence:CCGGAGTGCCCTTCAGGCAAGATTGCTCGAGCAATCTTGCCTGAAGGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-1513s21c1
Sequence:CCGGTAGCAATGCACAGCCAATTTCCTCGAGGAAATTGGCTGTGCATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-510s21c1
Sequence:CCGGAGATTGCCATTCACCATAAACCTCGAGGTTTATGGTGAATGGCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-1150s21c1
Sequence:CCGGTTACCGACAAAGATGACTTAGCTCGAGCTAAGTCATCTTTGTCGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-470s21c1
Sequence:CCGGACACTCCAGTATAGCCGAAATCTCGAGATTTCGGCTATACTGGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-604s21c1
Sequence:CCGGCACCAATACGACATCACTTAACTCGAGTTAAGTGATGTCGTATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152415.1-1474s1c1
Sequence:CCGGCCTGGAAACATGAACTGCCAACTCGAGTTGGCAGTTCATGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_152415.1-1074s1c1
Sequence:CCGGCCGACAAAGATGACTTAGTAACTCGAGTTACTAAGTCATCTTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152415.1-533s1c1
Sequence:CCGGCGACATCACTTAATGGATAAACTCGAGTTTATCCATTAAGTGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152415.1-443s1c1
Sequence:CCGGACCATAAACAACCTGACAATTCTCGAGAATTGTCAGGTTGTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152415.1-1446s1c1
Sequence:CCGGGCCAATTTCATGCTCCACTATCTCGAGATAGTGGAGCATGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152415
VALIDATED
VPS37A MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 37 homolog A (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-1335s21c1
Sequence:CCGGAGTGCCCTTCAGGCAAGATTGCTCGAGCAATCTTGCCTGAAGGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-1513s21c1
Sequence:CCGGTAGCAATGCACAGCCAATTTCCTCGAGGAAATTGGCTGTGCATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-510s21c1
Sequence:CCGGAGATTGCCATTCACCATAAACCTCGAGGTTTATGGTGAATGGCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-1150s21c1
Sequence:CCGGTTACCGACAAAGATGACTTAGCTCGAGCTAAGTCATCTTTGTCGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-470s21c1
Sequence:CCGGACACTCCAGTATAGCCGAAATCTCGAGATTTCGGCTATACTGGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-604s21c1
Sequence:CCGGCACCAATACGACATCACTTAACTCGAGTTAAGTGATGTCGTATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152415.1-1474s1c1
Sequence:CCGGCCTGGAAACATGAACTGCCAACTCGAGTTGGCAGTTCATGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_152415.1-1074s1c1
Sequence:CCGGCCGACAAAGATGACTTAGTAACTCGAGTTACTAAGTCATCTTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152415.1-533s1c1
Sequence:CCGGCGACATCACTTAATGGATAAACTCGAGTTTATCCATTAAGTGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152415.1-443s1c1
Sequence:CCGGACCATAAACAACCTGACAATTCTCGAGAATTGTCAGGTTGTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152415.1-1446s1c1
Sequence:CCGGGCCAATTTCATGCTCCACTATCTCGAGATAGTGGAGCATGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152415
VALIDATED
VPS37A MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 37 homolog A (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-1335s21c1
Sequence:CCGGAGTGCCCTTCAGGCAAGATTGCTCGAGCAATCTTGCCTGAAGGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-1513s21c1
Sequence:CCGGTAGCAATGCACAGCCAATTTCCTCGAGGAAATTGGCTGTGCATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-510s21c1
Sequence:CCGGAGATTGCCATTCACCATAAACCTCGAGGTTTATGGTGAATGGCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-1150s21c1
Sequence:CCGGTTACCGACAAAGATGACTTAGCTCGAGCTAAGTCATCTTTGTCGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-470s21c1
Sequence:CCGGACACTCCAGTATAGCCGAAATCTCGAGATTTCGGCTATACTGGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152415.2-604s21c1
Sequence:CCGGCACCAATACGACATCACTTAACTCGAGTTAAGTGATGTCGTATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152415.1-1474s1c1
Sequence:CCGGCCTGGAAACATGAACTGCCAACTCGAGTTGGCAGTTCATGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_152415.1-1074s1c1
Sequence:CCGGCCGACAAAGATGACTTAGTAACTCGAGTTACTAAGTCATCTTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152415.1-533s1c1
Sequence:CCGGCGACATCACTTAATGGATAAACTCGAGTTTATCCATTAAGTGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152415.1-443s1c1
Sequence:CCGGACCATAAACAACCTGACAATTCTCGAGAATTGTCAGGTTGTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152415.1-1446s1c1
Sequence:CCGGGCCAATTTCATGCTCCACTATCTCGAGATAGTGGAGCATGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033560
VALIDATED
VPS37A MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 37 homolog A (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033560.3-987s21c1
Sequence:CCGGGGTTATAAGATGCCGGATATTCTCGAGAATATCCGGCATCTTATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033560.3-1745s21c1
Sequence:CCGGCCTGTATTTAAGTTCCTCTATCTCGAGATAGAGGAACTTAAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033560.3-1485s21c1
Sequence:CCGGATAGCGATGCACAGCCAATTTCTCGAGAAATTGGCTGTGCATCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033560.3-1784s21c1
Sequence:CCGGGCATGTAATTCTAGCTAATTTCTCGAGAAATTAGCTAGAATTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033560.3-1504s21c1
Sequence:CCGGTTCATGCTCCTCTCTAGATTTCTCGAGAAATCTAGAGAGGAGCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033560.3-1347s21c1
Sequence:CCGGGCTGAGGAAGAATCGGATAATCTCGAGATTATCCGATTCTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033560.3-597s21c1
Sequence:CCGGATGGATAGTCAAGGATTATATCTCGAGATATAATCCTTGACTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1300s1c1
Sequence:CCGGGAAGCTGAGGAAGAATCGGATCTCGAGATCCGATTCTTCCTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033560.2-579s1c1
Sequence:CCGGCTCTCCATTAGTAAGCAATTTCTCGAGAAATTGCTTACTAATGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1030s1c1
Sequence:CCGGGAGGTATTACTAGAACAGTTTCTCGAGAAACTGTTCTAGTAATACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1303s1c1
Sequence:CCGGGCTGAGGAAGAATCGGATAATCTCGAGATTATCCGATTCTTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1701s1c1
Sequence:CCGGCCTGTATTTAAGTTCCTCTATCTCGAGATAGAGGAACTTAAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033560
VALIDATED
VPS37A MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 37 homolog A (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033560.3-987s21c1
Sequence:CCGGGGTTATAAGATGCCGGATATTCTCGAGAATATCCGGCATCTTATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033560.3-1745s21c1
Sequence:CCGGCCTGTATTTAAGTTCCTCTATCTCGAGATAGAGGAACTTAAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033560.3-1485s21c1
Sequence:CCGGATAGCGATGCACAGCCAATTTCTCGAGAAATTGGCTGTGCATCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033560.3-1784s21c1
Sequence:CCGGGCATGTAATTCTAGCTAATTTCTCGAGAAATTAGCTAGAATTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033560.3-1504s21c1
Sequence:CCGGTTCATGCTCCTCTCTAGATTTCTCGAGAAATCTAGAGAGGAGCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033560.3-1347s21c1
Sequence:CCGGGCTGAGGAAGAATCGGATAATCTCGAGATTATCCGATTCTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033560.3-597s21c1
Sequence:CCGGATGGATAGTCAAGGATTATATCTCGAGATATAATCCTTGACTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1300s1c1
Sequence:CCGGGAAGCTGAGGAAGAATCGGATCTCGAGATCCGATTCTTCCTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033560.2-579s1c1
Sequence:CCGGCTCTCCATTAGTAAGCAATTTCTCGAGAAATTGCTTACTAATGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1030s1c1
Sequence:CCGGGAGGTATTACTAGAACAGTTTCTCGAGAAACTGTTCTAGTAATACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1303s1c1
Sequence:CCGGGCTGAGGAAGAATCGGATAATCTCGAGATTATCCGATTCTTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1701s1c1
Sequence:CCGGCCTGTATTTAAGTTCCTCTATCTCGAGATAGAGGAACTTAAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033560
VALIDATED
VPS37A MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 37 homolog A (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033560.3-987s21c1
Sequence:CCGGGGTTATAAGATGCCGGATATTCTCGAGAATATCCGGCATCTTATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033560.3-1745s21c1
Sequence:CCGGCCTGTATTTAAGTTCCTCTATCTCGAGATAGAGGAACTTAAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033560.3-1485s21c1
Sequence:CCGGATAGCGATGCACAGCCAATTTCTCGAGAAATTGGCTGTGCATCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033560.3-1784s21c1
Sequence:CCGGGCATGTAATTCTAGCTAATTTCTCGAGAAATTAGCTAGAATTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033560.3-1504s21c1
Sequence:CCGGTTCATGCTCCTCTCTAGATTTCTCGAGAAATCTAGAGAGGAGCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033560.3-1347s21c1
Sequence:CCGGGCTGAGGAAGAATCGGATAATCTCGAGATTATCCGATTCTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033560.3-597s21c1
Sequence:CCGGATGGATAGTCAAGGATTATATCTCGAGATATAATCCTTGACTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1300s1c1
Sequence:CCGGGAAGCTGAGGAAGAATCGGATCTCGAGATCCGATTCTTCCTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033560.2-579s1c1
Sequence:CCGGCTCTCCATTAGTAAGCAATTTCTCGAGAAATTGCTTACTAATGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1030s1c1
Sequence:CCGGGAGGTATTACTAGAACAGTTTCTCGAGAAACTGTTCTAGTAATACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1303s1c1
Sequence:CCGGGCTGAGGAAGAATCGGATAATCTCGAGATTATCCGATTCTTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033560.2-1701s1c1
Sequence:CCGGCCTGTATTTAAGTTCCTCTATCTCGAGATAGAGGAACTTAAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks