EMAIL THIS PAGE TO A FRIEND

VPS37B

vacuolar protein sorting 37 homolog B (S. cerevisiae)

UniProtKB ID: Q9H9H4
Gene ID:
Mouse(330192) vacuolar protein sorting 37B (yeast)
Rat(288659) vacuolar protein sorting 37 homolog B (S. cerevisiae)
domestic guinea pig(100722778) vacuolar protein sorting 37 homolog B (S. cerevisiae)
naked mole-rat(101715183) vacuolar protein sorting 37 homolog B (S. cerevisiae)
cow(535566) vacuolar protein sorting 37 homolog B (S. cerevisiae)
sheep(101123071) vacuolar protein sorting 37 homolog B (S. cerevisiae)
chicken(416835) vacuolar protein sorting 37 homolog B (S. cerevisiae)
domestic cat(101090470) vacuolar protein sorting 37 homolog B (S. cerevisiae)
dog(477457) vacuolar protein sorting 37 homolog B (S. cerevisiae)
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024667 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024667 Rosetta Predictions human pricing
NM_001105928 Rosetta Predictions rat pricing
NM_177876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119805 predicted 346
2 SASI_Hs01_00119806 predicted 1187
3 SASI_Hs01_00119807 predicted 1131
4 SASI_Hs01_00119808 predicted 1176
5 SASI_Hs01_00119809 predicted 1303
6 SASI_Hs01_00119810 predicted 337
7 SASI_Hs02_00357079 predicted 1213
8 SASI_Hs02_00357080 predicted 1227
9 SASI_Hs02_00357081 predicted 966
10 SASI_Hs01_00119813 predicted 1349
11 SASI_Hs01_00119811 predicted 1347
12 SASI_Hs01_00119812 predicted 316
13 SASI_Hs01_00119814 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213922 predicted 440
2 SASI_Rn02_00213923 predicted 1104
3 SASI_Rn02_00213924 predicted 310
4 SASI_Rn02_00213925 predicted 349
5 SASI_Rn02_00213926 predicted 904
6 SASI_Rn02_00213927 predicted 1211
7 SASI_Rn02_00213928 predicted 999
8 SASI_Rn02_00213929 predicted 956
9 SASI_Rn02_00213930 predicted 422
10 SASI_Rn02_00213931 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086608 predicted 354
2 SASI_Mm01_00086609 predicted 1086
3 SASI_Mm01_00086610 predicted 321
4 SASI_Mm01_00086611 predicted 439
5 SASI_Mm01_00086612 predicted 435
6 SASI_Mm01_00086613 predicted 1100
7 SASI_Mm01_00086614 predicted 282
8 SASI_Mm02_00348359 predicted 444
9 SASI_Mm01_00086615 predicted 1212
10 SASI_Mm01_00086616 predicted 1162
11 SASI_Mm01_00086617 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024667
VALIDATED
VPS37B MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 37 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-360s1c1
Sequence:CCGGCCTATCAGATAAAGAAGACCACTCGAGTGGTCTTCTTTATCTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_024667.1-1672s1c1
Sequence:CCGGCCTGAAGGTTTCTATGAAGAACTCGAGTTCTTCATAGAAACCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024667.1-451s1c1
Sequence:CCGGGATTGAGGAAGACACTGAGAACTCGAGTTCTCAGTGTCTTCCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-1811s1c1
Sequence:CCGGGCAGATCGAAATGCCGATGAACTCGAGTTCATCGGCATTTCGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024667.1-343s1c1
Sequence:CCGGCCAGGTTCTCTTTGAAGCCTACTCGAGTAGGCTTCAAAGAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024667.1-1823s1c1
Sequence:CCGGGCCGATGAAGTGGATGCAATTCTCGAGAATTGCATCCACTTCATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-458s1c1
Sequence:CCGGGAAGACACTGAGAACATGGCACTCGAGTGCCATGTTCTCAGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-212s1c1
Sequence:CCGGGAGACACAGAATGTTCAGCTTCTCGAGAAGCTGAACATTCTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024667.1-413s1c1
Sequence:CCGGGAGACCCTGTTAGCACTTCTTCTCGAGAAGAAGTGCTAACAGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024667.1-218s1c1
Sequence:CCGGCAGAATGTTCAGCTTAACAAACTCGAGTTTGTTAAGCTGAACATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024667.2-1313s21c1
Sequence:GTACCGGAGCATGGTTCATGATACTTATCTCGAGATAAGTATCATGAACCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024667
VALIDATED
VPS37B MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 37 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-360s1c1
Sequence:CCGGCCTATCAGATAAAGAAGACCACTCGAGTGGTCTTCTTTATCTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_024667.1-1672s1c1
Sequence:CCGGCCTGAAGGTTTCTATGAAGAACTCGAGTTCTTCATAGAAACCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024667.1-451s1c1
Sequence:CCGGGATTGAGGAAGACACTGAGAACTCGAGTTCTCAGTGTCTTCCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-1811s1c1
Sequence:CCGGGCAGATCGAAATGCCGATGAACTCGAGTTCATCGGCATTTCGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024667.1-343s1c1
Sequence:CCGGCCAGGTTCTCTTTGAAGCCTACTCGAGTAGGCTTCAAAGAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024667.1-1823s1c1
Sequence:CCGGGCCGATGAAGTGGATGCAATTCTCGAGAATTGCATCCACTTCATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-458s1c1
Sequence:CCGGGAAGACACTGAGAACATGGCACTCGAGTGCCATGTTCTCAGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-212s1c1
Sequence:CCGGGAGACACAGAATGTTCAGCTTCTCGAGAAGCTGAACATTCTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024667.1-413s1c1
Sequence:CCGGGAGACCCTGTTAGCACTTCTTCTCGAGAAGAAGTGCTAACAGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024667.1-218s1c1
Sequence:CCGGCAGAATGTTCAGCTTAACAAACTCGAGTTTGTTAAGCTGAACATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024667.2-1313s21c1
Sequence:GTACCGGAGCATGGTTCATGATACTTATCTCGAGATAAGTATCATGAACCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024667
VALIDATED
VPS37B MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 37 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-360s1c1
Sequence:CCGGCCTATCAGATAAAGAAGACCACTCGAGTGGTCTTCTTTATCTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_024667.1-1672s1c1
Sequence:CCGGCCTGAAGGTTTCTATGAAGAACTCGAGTTCTTCATAGAAACCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024667.1-451s1c1
Sequence:CCGGGATTGAGGAAGACACTGAGAACTCGAGTTCTCAGTGTCTTCCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-1811s1c1
Sequence:CCGGGCAGATCGAAATGCCGATGAACTCGAGTTCATCGGCATTTCGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024667.1-343s1c1
Sequence:CCGGCCAGGTTCTCTTTGAAGCCTACTCGAGTAGGCTTCAAAGAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_024667.1-1823s1c1
Sequence:CCGGGCCGATGAAGTGGATGCAATTCTCGAGAATTGCATCCACTTCATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-458s1c1
Sequence:CCGGGAAGACACTGAGAACATGGCACTCGAGTGCCATGTTCTCAGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024667.1-212s1c1
Sequence:CCGGGAGACACAGAATGTTCAGCTTCTCGAGAAGCTGAACATTCTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_024667.1-413s1c1
Sequence:CCGGGAGACCCTGTTAGCACTTCTTCTCGAGAAGAAGTGCTAACAGGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024667.1-218s1c1
Sequence:CCGGCAGAATGTTCAGCTTAACAAACTCGAGTTTGTTAAGCTGAACATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024667.2-1313s21c1
Sequence:GTACCGGAGCATGGTTCATGATACTTATCTCGAGATAAGTATCATGAACCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177876
VALIDATED
VPS37B MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 37 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-438s21c1
Sequence:CCGGTGGAGAGCTTCCTCTAGATTCCTCGAGGAATCTAGAGGAAGCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-164s21c1
Sequence:CCGGAGACGGTTCAGCTTAACAAAGCTCGAGCTTTGTTAAGCTGAACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-742s21c1
Sequence:CCGGGTTTCTGCATACCCGGGATTACTCGAGTAATCCCGGGTATGCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-2187s21c1
Sequence:CCGGCAGTCAAGGCAGCGCTGATTACTCGAGTAATCAGCGCTGCCTTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177876.4-298s21c1
Sequence:CCGGTTTGAGGCCTATCAGATAAAGCTCGAGCTTTATCTGATAGGCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177876
VALIDATED
VPS37B MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 37 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-438s21c1
Sequence:CCGGTGGAGAGCTTCCTCTAGATTCCTCGAGGAATCTAGAGGAAGCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-164s21c1
Sequence:CCGGAGACGGTTCAGCTTAACAAAGCTCGAGCTTTGTTAAGCTGAACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-742s21c1
Sequence:CCGGGTTTCTGCATACCCGGGATTACTCGAGTAATCCCGGGTATGCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-2187s21c1
Sequence:CCGGCAGTCAAGGCAGCGCTGATTACTCGAGTAATCAGCGCTGCCTTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177876.4-298s21c1
Sequence:CCGGTTTGAGGCCTATCAGATAAAGCTCGAGCTTTATCTGATAGGCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177876
VALIDATED
VPS37B MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 37 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-438s21c1
Sequence:CCGGTGGAGAGCTTCCTCTAGATTCCTCGAGGAATCTAGAGGAAGCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-164s21c1
Sequence:CCGGAGACGGTTCAGCTTAACAAAGCTCGAGCTTTGTTAAGCTGAACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-742s21c1
Sequence:CCGGGTTTCTGCATACCCGGGATTACTCGAGTAATCCCGGGTATGCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177876.4-2187s21c1
Sequence:CCGGCAGTCAAGGCAGCGCTGATTACTCGAGTAATCAGCGCTGCCTTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177876.4-298s21c1
Sequence:CCGGTTTGAGGCCTATCAGATAAAGCTCGAGCTTTATCTGATAGGCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks