EMAIL THIS PAGE TO A FRIEND

VPS37C

vacuolar protein sorting 37 homolog C (S. cerevisiae)

UniProtKB ID: A5D8V6, Q8N3K4
Gene ID:
Human(55048) Summary: VPS37C is a subunit of ESCRT-I (endosomal sorting complex required for transport I), a complex in the class E vacuolar protein sorting (VPS) pathway required for sorting ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies (Eastman et al., 2005 [PubMed 15509564]
Mouse(107305) vacuolar protein sorting 37C (yeast)
Rat(308178) vacuolar protein sorting 37 homolog C (S. cerevisiae)
chicken(423023) vacuolar protein sorting 37 homolog C (S. cerevisiae)
dog(483803) vacuolar protein sorting 37 homolog C (S. cerevisiae)
domestic cat(101083544) vacuolar protein sorting 37 homolog C (S. cerevisiae)
cow(613817) vacuolar protein sorting 37 homolog C (S. cerevisiae)
sheep(101122144) vacuolar protein sorting 37 homolog C (S. cerevisiae)
naked mole-rat(101721739) vacuolar protein sorting 37 homolog C (S. cerevisiae)
domestic guinea pig(100722331) vacuolar protein sorting 37 homolog C (S. cerevisiae)
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017966 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017966 Rosetta Predictions human pricing
NM_001107463 Rosetta Predictions rat pricing
NM_181403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110590 predicted 1416
2 SASI_Hs01_00110591 predicted 1417
3 SASI_Hs01_00110592 predicted 652
4 SASI_Hs01_00110593 predicted 243
5 SASI_Hs01_00110594 predicted 523
6 SASI_Hs01_00110595 predicted 1282
7 SASI_Hs02_00351002 predicted 1292
8 SASI_Hs01_00110596 predicted 312
9 SASI_Hs01_00110598 predicted 1459
10 SASI_Hs01_00110599 predicted 1557
11 SASI_Hs01_00110597 predicted 1479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229075 predicted 268
2 SASI_Rn02_00229076 predicted 384
3 SASI_Rn02_00229077 predicted 1248
4 SASI_Rn02_00229078 predicted 581
5 SASI_Rn02_00229079 predicted 1535
6 SASI_Rn02_00229080 predicted 1380
7 SASI_Rn02_00229081 predicted 509
8 SASI_Rn02_00229082 predicted 963
9 SASI_Rn02_00229083 predicted 1384
10 SASI_Rn02_00229084 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067457 predicted 484
2 SASI_Mm01_00067458 predicted 1667
3 SASI_Mm01_00067459 predicted 344
4 SASI_Mm01_00067460 predicted 1366
5 SASI_Mm01_00067461 predicted 1646
6 SASI_Mm01_00067462 predicted 759
7 SASI_Mm01_00067463 predicted 1300
8 SASI_Mm01_00067464 predicted 1285
9 SASI_Mm01_00067465 predicted 1682
10 SASI_Mm01_00067466 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017966
VALIDATED
VPS37C MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 37 homolog C (S. cerevisiae)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017966.4-107s21c1
Sequence:CCGGAGAATGACTCGGAGGCGATTGCTCGAGCAATCGCCTCCGAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017966.4-1414s21c1
Sequence:CCGGTGAGCGCATGTGCGCATTTATCTCGAGATAAATGCGCACATGCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017966.4-381s21c1
Sequence:CCGGAGGCATGAAGATCGAAGAAGACTCGAGTCTTCTTCGATCTTCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017966.4-253s21c1
Sequence:CCGGTCAAACCTCTCGGATAGATACCTCGAGGTATCTATCCGAGAGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017966.4-447s21c1
Sequence:CCGGGGAAACGTTCCTGGAGAATTTCTCGAGAAATTCTCCAGGAACGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017966.4-2127s1c1
Sequence:CCGGGCCCTAACTTTACTTCCCAAACTCGAGTTTGGGAAGTAAAGTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017966.4-251s1c1
Sequence:CCGGGCTCAAACCTCTCGGATAGATCTCGAGATCTATCCGAGAGGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017966
VALIDATED
VPS37C MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 37 homolog C (S. cerevisiae)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017966.4-107s21c1
Sequence:CCGGAGAATGACTCGGAGGCGATTGCTCGAGCAATCGCCTCCGAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017966.4-1414s21c1
Sequence:CCGGTGAGCGCATGTGCGCATTTATCTCGAGATAAATGCGCACATGCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017966.4-381s21c1
Sequence:CCGGAGGCATGAAGATCGAAGAAGACTCGAGTCTTCTTCGATCTTCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017966.4-253s21c1
Sequence:CCGGTCAAACCTCTCGGATAGATACCTCGAGGTATCTATCCGAGAGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017966.4-447s21c1
Sequence:CCGGGGAAACGTTCCTGGAGAATTTCTCGAGAAATTCTCCAGGAACGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017966.4-2127s1c1
Sequence:CCGGGCCCTAACTTTACTTCCCAAACTCGAGTTTGGGAAGTAAAGTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017966.4-251s1c1
Sequence:CCGGGCTCAAACCTCTCGGATAGATCTCGAGATCTATCCGAGAGGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017966
VALIDATED
VPS37C MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 37 homolog C (S. cerevisiae)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017966.4-107s21c1
Sequence:CCGGAGAATGACTCGGAGGCGATTGCTCGAGCAATCGCCTCCGAGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017966.4-1414s21c1
Sequence:CCGGTGAGCGCATGTGCGCATTTATCTCGAGATAAATGCGCACATGCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017966.4-381s21c1
Sequence:CCGGAGGCATGAAGATCGAAGAAGACTCGAGTCTTCTTCGATCTTCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017966.4-253s21c1
Sequence:CCGGTCAAACCTCTCGGATAGATACCTCGAGGTATCTATCCGAGAGGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017966.4-447s21c1
Sequence:CCGGGGAAACGTTCCTGGAGAATTTCTCGAGAAATTCTCCAGGAACGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017966.4-2127s1c1
Sequence:CCGGGCCCTAACTTTACTTCCCAAACTCGAGTTTGGGAAGTAAAGTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017966.4-251s1c1
Sequence:CCGGGCTCAAACCTCTCGGATAGATCTCGAGATCTATCCGAGAGGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181403
VPS37C MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 37 homolog C (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181403.2-2026s1c1
Sequence:CCGGCTTTAGTGCCTTGAATCTTATCTCGAGATAAGATTCAAGGCACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-211s1c1
Sequence:CCGGGAAATGCAGAATGACCCAGAACTCGAGTTCTGGGTCATTCTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-559s1c1
Sequence:CCGGGAAACGTTCTTAGAGTCCTTTCTCGAGAAAGGACTCTAAGAACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181403.2-1622s1c1
Sequence:CCGGCCCTTGGAGCTTGGTATGTTTCTCGAGAAACATACCAAGCTCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-265s1c1
Sequence:CCGGGTTCAGGACCTGCAGTTAGAACTCGAGTTCTAACTGCAGGTCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181403.2-526s1c1
Sequence:CCGGGCTGAGAAATTCCTGGAAGGTCTCGAGACCTTCCAGGAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-935s1c1
Sequence:CCGGGTTACTCTTGGTCTCCACAGACTCGAGTCTGTGGAGACCAAGAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181403.2-369s1c1
Sequence:CCGGCCTCTCAGACAAATACCAGGACTCGAGTCCTGGTATTTGTCTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181403
VPS37C MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 37 homolog C (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181403.2-2026s1c1
Sequence:CCGGCTTTAGTGCCTTGAATCTTATCTCGAGATAAGATTCAAGGCACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-211s1c1
Sequence:CCGGGAAATGCAGAATGACCCAGAACTCGAGTTCTGGGTCATTCTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-559s1c1
Sequence:CCGGGAAACGTTCTTAGAGTCCTTTCTCGAGAAAGGACTCTAAGAACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181403.2-1622s1c1
Sequence:CCGGCCCTTGGAGCTTGGTATGTTTCTCGAGAAACATACCAAGCTCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-265s1c1
Sequence:CCGGGTTCAGGACCTGCAGTTAGAACTCGAGTTCTAACTGCAGGTCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181403.2-526s1c1
Sequence:CCGGGCTGAGAAATTCCTGGAAGGTCTCGAGACCTTCCAGGAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-935s1c1
Sequence:CCGGGTTACTCTTGGTCTCCACAGACTCGAGTCTGTGGAGACCAAGAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181403.2-369s1c1
Sequence:CCGGCCTCTCAGACAAATACCAGGACTCGAGTCCTGGTATTTGTCTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181403
VPS37C MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 37 homolog C (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181403.2-2026s1c1
Sequence:CCGGCTTTAGTGCCTTGAATCTTATCTCGAGATAAGATTCAAGGCACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-211s1c1
Sequence:CCGGGAAATGCAGAATGACCCAGAACTCGAGTTCTGGGTCATTCTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-559s1c1
Sequence:CCGGGAAACGTTCTTAGAGTCCTTTCTCGAGAAAGGACTCTAAGAACGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181403.2-1622s1c1
Sequence:CCGGCCCTTGGAGCTTGGTATGTTTCTCGAGAAACATACCAAGCTCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-265s1c1
Sequence:CCGGGTTCAGGACCTGCAGTTAGAACTCGAGTTCTAACTGCAGGTCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181403.2-526s1c1
Sequence:CCGGGCTGAGAAATTCCTGGAAGGTCTCGAGACCTTCCAGGAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181403.2-935s1c1
Sequence:CCGGGTTACTCTTGGTCTCCACAGACTCGAGTCTGTGGAGACCAAGAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181403.2-369s1c1
Sequence:CCGGCCTCTCAGACAAATACCAGGACTCGAGTCCTGGTATTTGTCTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks