EMAIL THIS PAGE TO A FRIEND

VPS37D

vacuolar protein sorting 37 homolog D (S. cerevisiae)

Synonyms: WBSCR24
UniProtKB ID: Q86XT2, Q6P2C3
Gene ID:
Mouse(194309) vacuolar protein sorting 37D (yeast)
Rat(687208) vacuolar protein sorting 37 homolog D (S. cerevisiae)
domestic guinea pig(100729542) vacuolar protein sorting 37 homolog D (S. cerevisiae)
naked mole-rat(101706319) vacuolar protein sorting 37 homolog D (S. cerevisiae)
cow(539811) vacuolar protein sorting 37 homolog D (S. cerevisiae)
sheep(101113456) vacuolar protein sorting 37 homolog D (S. cerevisiae)
chicken(100859879) vacuolar protein sorting 37 homolog D (S. cerevisiae)
dog(489806) vacuolar protein sorting 37 homolog D (S. cerevisiae)
domestic cat(101096626) vacuolar protein sorting 37 homolog D (S. cerevisiae)
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA040978 Anti-VPS37D antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001077621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077621 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000111 MISSION® esiRNA esiRNA targeting mouse Vps37d (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077621 Rosetta Predictions human pricing
XM_376631 Rosetta Predictions human pricing
NM_001128193 Rosetta Predictions rat pricing
NM_177574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313014 predicted 1075
2 SASI_Hs02_00313015 predicted 411
3 SASI_Hs02_00313016 predicted 404
4 SASI_Hs02_00313017 predicted 1066
5 SASI_Hs02_00313018 predicted 1252
6 SASI_Hs02_00313019 predicted 385
7 SASI_Hs02_00313020 predicted 365
8 SASI_Hs02_00313021 predicted 1224
9 SASI_Hs02_00313022 predicted 1232
10 SASI_Hs02_00313023 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300307 predicted 1643
2 SASI_Hs01_00300308 predicted 1668
3 SASI_Hs01_00300309 predicted 1667
4 SASI_Hs01_00300310 predicted 1644
5 SASI_Hs01_00300311 predicted 1646
6 SASI_Hs01_00300312 predicted 1666
7 SASI_Hs01_00300313 predicted 1672
8 SASI_Hs01_00300314 predicted 1499
9 SASI_Hs01_00300315 predicted 285
10 SASI_Hs01_00300316 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255110 predicted 549
2 SASI_Rn02_00255111 predicted 343
3 SASI_Rn02_00255112 predicted 553
4 SASI_Rn02_00255113 predicted 1287
5 SASI_Rn02_00255114 predicted 337
6 SASI_Rn02_00255115 predicted 342
7 SASI_Rn02_00255116 predicted 531
8 SASI_Rn02_00255117 predicted 582
9 SASI_Rn02_00255118 predicted 326
10 SASI_Rn02_00255119 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052339 predicted 518
2 SASI_Mm01_00052340 predicted 520
3 SASI_Mm01_00052341 predicted 320
4 SASI_Mm01_00052342 predicted 382
5 SASI_Mm01_00052343 predicted 558
6 SASI_Mm01_00052344 predicted 410
7 SASI_Mm01_00052346 predicted 966
8 SASI_Mm01_00052347 predicted 978
9 SASI_Mm01_00052348 predicted 860
10 SASI_Mm02_00347735 predicted 981
11 SASI_Mm01_00052345 predicted 569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177574
VPS37D MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 37 homolog D (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-959s21c1
Sequence:CCGGACACTACTGGGCTCGAACAACCTCGAGGTTGTTCGAGCCCAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-872s21c1
Sequence:CCGGCCAAGCCAGGTCCTCAAATGACTCGAGTCATTTGAGGACCTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177574.3-146s21c1
Sequence:CCGGCTCCGGGATCTGCTTCAAGATCTCGAGATCTTGAAGCAGATCCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-988s21c1
Sequence:CCGGCTTACTGGATTGTTCTCATATCTCGAGATATGAGAACAATCCAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-624s21c1
Sequence:CCGGGGGTCCAGACAAACTTGATTCCTCGAGGAATCAAGTTTGTCTGGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177574
VPS37D MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 37 homolog D (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-959s21c1
Sequence:CCGGACACTACTGGGCTCGAACAACCTCGAGGTTGTTCGAGCCCAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-872s21c1
Sequence:CCGGCCAAGCCAGGTCCTCAAATGACTCGAGTCATTTGAGGACCTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177574.3-146s21c1
Sequence:CCGGCTCCGGGATCTGCTTCAAGATCTCGAGATCTTGAAGCAGATCCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-988s21c1
Sequence:CCGGCTTACTGGATTGTTCTCATATCTCGAGATATGAGAACAATCCAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-624s21c1
Sequence:CCGGGGGTCCAGACAAACTTGATTCCTCGAGGAATCAAGTTTGTCTGGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177574
VPS37D MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 37 homolog D (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-959s21c1
Sequence:CCGGACACTACTGGGCTCGAACAACCTCGAGGTTGTTCGAGCCCAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-872s21c1
Sequence:CCGGCCAAGCCAGGTCCTCAAATGACTCGAGTCATTTGAGGACCTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177574.3-146s21c1
Sequence:CCGGCTCCGGGATCTGCTTCAAGATCTCGAGATCTTGAAGCAGATCCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-988s21c1
Sequence:CCGGCTTACTGGATTGTTCTCATATCTCGAGATATGAGAACAATCCAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177574.3-624s21c1
Sequence:CCGGGGGTCCAGACAAACTTGATTCCTCGAGGAATCAAGTTTGTCTGGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077621
VALIDATED
VPS37D MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 37 homolog D (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077621.1-352s21c1
Sequence:CCGGGGCTGCCCTGGCCATCAAATACTCGAGTATTTGATGGCCAGGGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077621.1-1283s21c1
Sequence:CCGGCATGTCCTGAGCCTACCTTTCCTCGAGGAAAGGTAGGCTCAGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077621.1-370s21c1
Sequence:CCGGATACCAGGAGCTTCGTGAGGTCTCGAGACCTCACGAAGCTCCTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077621.1-420s21c1
Sequence:CCGGGACTGGAGGAAAGCATGCATCCTCGAGGATGCATGCTTTCCTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077621.1-478s21c1
Sequence:CCGGTGAGCTAGAAGAGGCGGAGCACTCGAGTGCTCCGCCTCTTCTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077621
VALIDATED
VPS37D MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 37 homolog D (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077621.1-352s21c1
Sequence:CCGGGGCTGCCCTGGCCATCAAATACTCGAGTATTTGATGGCCAGGGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077621.1-1283s21c1
Sequence:CCGGCATGTCCTGAGCCTACCTTTCCTCGAGGAAAGGTAGGCTCAGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077621.1-370s21c1
Sequence:CCGGATACCAGGAGCTTCGTGAGGTCTCGAGACCTCACGAAGCTCCTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077621.1-420s21c1
Sequence:CCGGGACTGGAGGAAAGCATGCATCCTCGAGGATGCATGCTTTCCTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077621.1-478s21c1
Sequence:CCGGTGAGCTAGAAGAGGCGGAGCACTCGAGTGCTCCGCCTCTTCTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077621
VALIDATED
VPS37D MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 37 homolog D (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077621.1-352s21c1
Sequence:CCGGGGCTGCCCTGGCCATCAAATACTCGAGTATTTGATGGCCAGGGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077621.1-1283s21c1
Sequence:CCGGCATGTCCTGAGCCTACCTTTCCTCGAGGAAAGGTAGGCTCAGGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077621.1-370s21c1
Sequence:CCGGATACCAGGAGCTTCGTGAGGTCTCGAGACCTCACGAAGCTCCTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001077621.1-420s21c1
Sequence:CCGGGACTGGAGGAAAGCATGCATCCTCGAGGATGCATGCTTTCCTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077621.1-478s21c1
Sequence:CCGGTGAGCTAGAAGAGGCGGAGCACTCGAGTGCTCCGCCTCTTCTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks