EMAIL THIS PAGE TO A FRIEND

VPS39

vacuolar protein sorting 39 homolog (S. cerevisiae)

Synonyms: TLP VAM6 hVam6p
UniProtKB ID: Q96JC1, O94869, Q71SQ6, Q7Z3V3, Q96B93, Q96RM0
Gene ID:
Human(23339) Summary: This gene encodes a protein that may promote clustering and fusion of late endosomes and lysosomes. The protein may also act as an adaptor protein that modulates the transforming growth factor-beta response by coupling the transforming growth factor-beta receptor complex to the Smad pathway. [provided by RefSeq, Jul 2008]
Mouse(269338) vacuolar protein sorting 39 (yeast)
Rat(362199) vacuolar protein sorting 39 homolog (S. cerevisiae)
Zebrafish(567078) vacuolar protein sorting 39 homolog (S. cerevisiae)
dog(487516) vacuolar protein sorting 39 homolog (S. cerevisiae)
domestic cat(101082411) vacuolar protein sorting 39 homolog (S. cerevisiae)
chicken(423230) vacuolar protein sorting 39 homolog (S. cerevisiae)
cow(520990) vacuolar protein sorting 39 homolog (S. cerevisiae)
sheep(101116657) vacuolar protein sorting 39 homolog (S. cerevisiae)
naked mole-rat(101706571) vacuolar protein sorting 39 homolog (S. cerevisiae)
Domestic Rabbit(100344431) vacuolar protein sorting 39 homolog (S. cerevisiae)
domestic guinea pig(100722013) vacuolar protein sorting 39 homolog (S. cerevisiae)
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015289 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015289 Rosetta Predictions human pricing
NM_001012186 Rosetta Predictions rat pricing
XM_001075756 Rosetta Predictions rat pricing
XM_001075777 Rosetta Predictions rat pricing
XM_575216 Rosetta Predictions rat pricing
NM_147153 Rosetta Predictions mouse pricing
NM_178851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041637 predicted 1350
2 SASI_Hs01_00041638 predicted 2574
3 SASI_Hs01_00041639 predicted 672
4 SASI_Hs02_00347475 predicted 245
5 SASI_Hs02_00347476 predicted 2284
6 SASI_Hs01_00041640 predicted 2488
7 SASI_Hs01_00041641 predicted 1607
8 SASI_Hs01_00041642 predicted 1594
9 SASI_Hs01_00041643 predicted 1510
10 SASI_Hs01_00041644 predicted 1932
11 SASI_Hs01_00041645 predicted 293
12 SASI_Hs01_00041646 predicted 2381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200391 predicted 2486
2 SASI_Rn02_00200392 predicted 240
3 SASI_Rn02_00200393 predicted 1132
4 SASI_Rn02_00200394 predicted 2309
5 SASI_Rn02_00200395 predicted 584
6 SASI_Rn02_00200396 predicted 2678
7 SASI_Rn02_00200397 predicted 2856
8 SASI_Rn02_00200398 predicted 2751
9 SASI_Rn02_00200399 predicted 302
10 SASI_Rn02_00200400 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350918 predicted 2517
2 SASI_Rn02_00350919 predicted 323
3 SASI_Rn02_00350920 predicted 239
4 SASI_Rn02_00350921 predicted 1171
5 SASI_Rn02_00350922 predicted 2342
6 SASI_Rn02_00350923 predicted 617
7 SASI_Rn02_00350924 predicted 2710
8 SASI_Rn02_00350925 predicted 2781
9 SASI_Rn02_00350926 predicted 338
10 SASI_Rn02_00350927 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350991 predicted 2485
2 SASI_Rn02_00350992 predicted 241
3 SASI_Rn02_00350993 predicted 1140
4 SASI_Rn02_00350994 predicted 2312
5 SASI_Rn02_00350995 predicted 585
6 SASI_Rn02_00350996 predicted 2676
7 SASI_Rn02_00350997 predicted 2855
8 SASI_Rn02_00350998 predicted 2747
9 SASI_Rn02_00350999 predicted 305
10 SASI_Rn02_00351000 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403317 predicted 2492
2 SASI_Rn02_00403318 predicted 243
3 SASI_Rn02_00403319 predicted 1133
4 SASI_Rn02_00403320 predicted 2306
5 SASI_Rn02_00403321 predicted 588
6 SASI_Rn02_00403322 predicted 2671
7 SASI_Rn02_00403323 predicted 2863
8 SASI_Rn02_00403324 predicted 2747
9 SASI_Rn02_00403325 predicted 305
10 SASI_Rn02_00403326 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062227 predicted 1355
2 SASI_Mm02_00342675 predicted 1606
3 SASI_Mm02_00342676 predicted 1885
4 SASI_Mm02_00342677 predicted 2170
5 SASI_Mm01_00062232 predicted 2311
6 SASI_Mm01_00062233 predicted 2226
7 SASI_Mm02_00342678 predicted 1510
8 SASI_Mm02_00342679 predicted 1202
9 SASI_Mm02_00342680 predicted 1225
10 SASI_Mm02_00342681 predicted 2270
11 SASI_Mm01_00062225 predicted 2756
12 SASI_Mm01_00062226 predicted 299
13 SASI_Mm01_00062228 predicted 299
14 SASI_Mm01_00062229 predicted 222
15 SASI_Mm01_00062230 predicted 2496
16 SASI_Mm01_00062231 predicted 2688
17 SASI_Mm01_00062234 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101347 predicted 1324
2 SASI_Mm01_00101349 predicted 1574
3 SASI_Mm02_00349423 predicted 1847
4 SASI_Mm02_00349424 predicted 2135
5 SASI_Mm01_00101353 predicted 2286
6 SASI_Mm01_00101354 predicted 2187
7 SASI_Mm02_00349425 predicted 1477
8 SASI_Mm02_00349426 predicted 1165
9 SASI_Mm02_00349427 predicted 1190
10 SASI_Mm02_00349428 predicted 2241
11 SASI_Mm01_00101346 predicted 2724
12 SASI_Mm01_00101348 predicted 701
13 SASI_Mm01_00101350 predicted 2486
14 SASI_Mm01_00101351 predicted 2465
15 SASI_Mm01_00101352 predicted 2649
16 SASI_Mm01_00101355 predicted 1450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015289
VALIDATED
VPS39 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 39 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015289.2-284s21c1
Sequence:GTACCGGGACGTTGGTTGCAACAGATTTCTCGAGAAATCTGTTGCAACCAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-789s21c1
Sequence:GTACCGGATCTCACCGTGGTACTCAATGCTCGAGCATTGAGTACCACGGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-1384s21c1
Sequence:GTACCGGGAAACGAAGTCAATTGGTAAACTCGAGTTTACCAATTGACTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015289.2-977s21c1
Sequence:GTACCGGATTACCTCAGGAGGATCAAACCTCGAGGTTTGATCCTCCTGAGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-413s21c1
Sequence:GTACCGGGTCCATGACCTATTGACATTTCTCGAGAAATGTCAATAGGTCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-2982s21c1
Sequence:GTACCGGGTTATACCTTATACCATTATGCTCGAGCATAATGGTATAAGGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-520s21c1
Sequence:GTACCGGACGGATGTGTGTGGCAGTAAACTCGAGTTTACTGCCACACACATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015289.1-359s1c1
Sequence:CCGGCCATGTGGTTTCCCAGTTTAACTCGAGTTAAACTGGGAAACCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015289.1-1883s1c1
Sequence:CCGGCCTCGGCTTCTTAATAGAGAACTCGAGTTCTCTATTAAGAAGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015289.1-2288s1c1
Sequence:CCGGCCACAAACACTATGACCGAAACTCGAGTTTCGGTCATAGTGTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015289.1-2744s1c1
Sequence:CCGGCTTCTGTTCCAAAGAGGTAAACTCGAGTTTACCTCTTTGGAACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_015289.1-2493s1c1
Sequence:CCGGCCAGCAAACACTCAGATCAATCTCGAGATTGATCTGAGTGTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015289.1-2675s1c1
Sequence:CCGGCATGGTGTGTAAGAAGAAGATCTCGAGATCTTCTTCTTACACACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015289
VALIDATED
VPS39 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 39 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015289.2-284s21c1
Sequence:GTACCGGGACGTTGGTTGCAACAGATTTCTCGAGAAATCTGTTGCAACCAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-789s21c1
Sequence:GTACCGGATCTCACCGTGGTACTCAATGCTCGAGCATTGAGTACCACGGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-1384s21c1
Sequence:GTACCGGGAAACGAAGTCAATTGGTAAACTCGAGTTTACCAATTGACTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015289.2-977s21c1
Sequence:GTACCGGATTACCTCAGGAGGATCAAACCTCGAGGTTTGATCCTCCTGAGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-413s21c1
Sequence:GTACCGGGTCCATGACCTATTGACATTTCTCGAGAAATGTCAATAGGTCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-2982s21c1
Sequence:GTACCGGGTTATACCTTATACCATTATGCTCGAGCATAATGGTATAAGGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-520s21c1
Sequence:GTACCGGACGGATGTGTGTGGCAGTAAACTCGAGTTTACTGCCACACACATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015289.1-359s1c1
Sequence:CCGGCCATGTGGTTTCCCAGTTTAACTCGAGTTAAACTGGGAAACCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015289.1-1883s1c1
Sequence:CCGGCCTCGGCTTCTTAATAGAGAACTCGAGTTCTCTATTAAGAAGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015289.1-2288s1c1
Sequence:CCGGCCACAAACACTATGACCGAAACTCGAGTTTCGGTCATAGTGTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015289.1-2744s1c1
Sequence:CCGGCTTCTGTTCCAAAGAGGTAAACTCGAGTTTACCTCTTTGGAACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_015289.1-2493s1c1
Sequence:CCGGCCAGCAAACACTCAGATCAATCTCGAGATTGATCTGAGTGTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015289.1-2675s1c1
Sequence:CCGGCATGGTGTGTAAGAAGAAGATCTCGAGATCTTCTTCTTACACACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015289
VALIDATED
VPS39 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 39 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015289.2-284s21c1
Sequence:GTACCGGGACGTTGGTTGCAACAGATTTCTCGAGAAATCTGTTGCAACCAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-789s21c1
Sequence:GTACCGGATCTCACCGTGGTACTCAATGCTCGAGCATTGAGTACCACGGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-1384s21c1
Sequence:GTACCGGGAAACGAAGTCAATTGGTAAACTCGAGTTTACCAATTGACTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015289.2-977s21c1
Sequence:GTACCGGATTACCTCAGGAGGATCAAACCTCGAGGTTTGATCCTCCTGAGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-413s21c1
Sequence:GTACCGGGTCCATGACCTATTGACATTTCTCGAGAAATGTCAATAGGTCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-2982s21c1
Sequence:GTACCGGGTTATACCTTATACCATTATGCTCGAGCATAATGGTATAAGGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015289.2-520s21c1
Sequence:GTACCGGACGGATGTGTGTGGCAGTAAACTCGAGTTTACTGCCACACACATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015289.1-359s1c1
Sequence:CCGGCCATGTGGTTTCCCAGTTTAACTCGAGTTAAACTGGGAAACCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015289.1-1883s1c1
Sequence:CCGGCCTCGGCTTCTTAATAGAGAACTCGAGTTCTCTATTAAGAAGCCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015289.1-2288s1c1
Sequence:CCGGCCACAAACACTATGACCGAAACTCGAGTTTCGGTCATAGTGTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015289.1-2744s1c1
Sequence:CCGGCTTCTGTTCCAAAGAGGTAAACTCGAGTTTACCTCTTTGGAACAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_015289.1-2493s1c1
Sequence:CCGGCCAGCAAACACTCAGATCAATCTCGAGATTGATCTGAGTGTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015289.1-2675s1c1
Sequence:CCGGCATGGTGTGTAAGAAGAAGATCTCGAGATCTTCTTCTTACACACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178851
VALIDATED
VPS39 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 39 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178851.3-2243s21c1
Sequence:CCGGCCACGTCTTGAAGGACACAAACTCGAGTTTGTGTCCTTCAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178851.3-296s21c1
Sequence:CCGGGTTTGAGGTAACACTAGAGAACTCGAGTTCTCTAGTGTTACCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178851.3-2486s21c1
Sequence:CCGGGCCAGCAAACACTCAGATCAACTCGAGTTGATCTGAGTGTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-2944s1c1
Sequence:CCGGCGCTGTTATGTTGCAGACAATCTCGAGATTGTCTGCAACATAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-273s1c1
Sequence:CCGGGTTTGAGGTAACACTAGAGAACTCGAGTTCTCTAGTGTTACCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-2220s1c1
Sequence:CCGGCCACGTCTTGAAGGACACAAACTCGAGTTTGTGTCCTTCAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178851.1-2463s1c1
Sequence:CCGGGCCAGCAAACACTCAGATCAACTCGAGTTGATCTGAGTGTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-624s1c1
Sequence:CCGGCGTTGGTTTCAAGAGAGACTACTCGAGTAGTCTCTCTTGAAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178851
VALIDATED
VPS39 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 39 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178851.3-2243s21c1
Sequence:CCGGCCACGTCTTGAAGGACACAAACTCGAGTTTGTGTCCTTCAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178851.3-296s21c1
Sequence:CCGGGTTTGAGGTAACACTAGAGAACTCGAGTTCTCTAGTGTTACCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178851.3-2486s21c1
Sequence:CCGGGCCAGCAAACACTCAGATCAACTCGAGTTGATCTGAGTGTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-2944s1c1
Sequence:CCGGCGCTGTTATGTTGCAGACAATCTCGAGATTGTCTGCAACATAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-273s1c1
Sequence:CCGGGTTTGAGGTAACACTAGAGAACTCGAGTTCTCTAGTGTTACCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-2220s1c1
Sequence:CCGGCCACGTCTTGAAGGACACAAACTCGAGTTTGTGTCCTTCAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178851.1-2463s1c1
Sequence:CCGGGCCAGCAAACACTCAGATCAACTCGAGTTGATCTGAGTGTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-624s1c1
Sequence:CCGGCGTTGGTTTCAAGAGAGACTACTCGAGTAGTCTCTCTTGAAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178851
VALIDATED
VPS39 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 39 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178851.3-2243s21c1
Sequence:CCGGCCACGTCTTGAAGGACACAAACTCGAGTTTGTGTCCTTCAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178851.3-296s21c1
Sequence:CCGGGTTTGAGGTAACACTAGAGAACTCGAGTTCTCTAGTGTTACCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178851.3-2486s21c1
Sequence:CCGGGCCAGCAAACACTCAGATCAACTCGAGTTGATCTGAGTGTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-2944s1c1
Sequence:CCGGCGCTGTTATGTTGCAGACAATCTCGAGATTGTCTGCAACATAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-273s1c1
Sequence:CCGGGTTTGAGGTAACACTAGAGAACTCGAGTTCTCTAGTGTTACCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-2220s1c1
Sequence:CCGGCCACGTCTTGAAGGACACAAACTCGAGTTTGTGTCCTTCAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178851.1-2463s1c1
Sequence:CCGGGCCAGCAAACACTCAGATCAACTCGAGTTGATCTGAGTGTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178851.1-624s1c1
Sequence:CCGGCGTTGGTTTCAAGAGAGACTACTCGAGTAGTCTCTCTTGAAACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks