EMAIL THIS PAGE TO A FRIEND

VPS41

vacuolar protein sorting 41 homolog (S. cerevisiae)

Synonyms: HVPS41 HVSP41 hVps41p
UniProtKB ID: P49754, Q86TP8, Q99851, Q99852
Gene ID:
Human(27072) Summary: Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human ortholog of yeast Vps41 protein which is also conserved in Drosophila, tomato, and Arabidopsis. Expression studies in yeast and human indicate that this protein may be involved in the formation and fusion of transport vesicles from the Golgi. Several transcript variants encoding different isoforms have been described for this gene, however, the full-length nature of not all is known. [provided by RefSeq, Jul 2008]
Mouse(218035) vacuolar protein sorting 41 (yeast)
Rat(306991) vacuolar protein sorting 41 homolog (S. cerevisiae)
Thale Cress(837340) vacuolar protein sorting-associated protein 41
Zebrafish(563215) vacuolar protein sorting 41 homolog (S. cerevisiae)
domestic cat(101099788) vacuolar protein sorting 41 homolog (S. cerevisiae)
Horse(100062843) vacuolar protein sorting 41 homolog (S. cerevisiae)
dog(475876) vacuolar protein sorting 41 homolog (S. cerevisiae)
chicken(420762) vacuolar protein sorting 41 homolog (S. cerevisiae)
domestic guinea pig(100719226) vacuolar protein sorting 41 homolog (S. cerevisiae)
naked mole-rat(101708027) vacuolar protein sorting 41 homolog (S. cerevisiae)
cow(528654) vacuolar protein sorting 41 homolog (S. cerevisiae)
sheep(101120659) vacuolar protein sorting 41 homolog (S. cerevisiae)
Gene Class: Cytoskeleton
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014396 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172120 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172120 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172120 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014396 Rosetta Predictions human pricing
NM_080631 Rosetta Predictions human pricing
NM_001107355 Rosetta Predictions rat pricing
XM_225396 Rosetta Predictions rat pricing
NM_172120 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018855 predicted 855
2 SASI_Hs01_00018856 predicted 2352
3 SASI_Hs01_00018857 predicted 2524
4 SASI_Hs01_00018858 predicted 1204
5 SASI_Hs01_00018859 predicted 1113
6 SASI_Hs01_00018860 predicted 2241
7 SASI_Hs01_00018861 predicted 781
8 SASI_Hs02_00345582 predicted 1886
9 SASI_Hs01_00018864 predicted 784
10 SASI_Hs02_00345583 predicted 2364
11 SASI_Hs01_00018862 predicted 2597
12 SASI_Hs01_00018863 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129756 predicted 781
2 SASI_Hs01_00129757 predicted 2273
3 SASI_Hs01_00129758 predicted 2446
4 SASI_Hs01_00129759 predicted 1127
5 SASI_Hs01_00129760 predicted 1036
6 SASI_Hs01_00129761 predicted 2162
7 SASI_Hs01_00129762 predicted 703
8 SASI_Hs02_00362378 predicted 1807
9 SASI_Hs01_00129765 predicted 717
10 SASI_Hs02_00362379 predicted 2284
11 SASI_Hs01_00129763 predicted 2428
12 SASI_Hs01_00129764 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228005 predicted 2266
2 SASI_Rn02_00228006 predicted 2136
3 SASI_Rn02_00228007 predicted 845
4 SASI_Rn02_00228008 predicted 793
5 SASI_Rn02_00228009 predicted 552
6 SASI_Rn02_00228010 predicted 1701
7 SASI_Rn02_00228011 predicted 1300
8 SASI_Rn02_00228012 predicted 1526
9 SASI_Rn02_00228013 predicted 1473
10 SASI_Rn02_00228014 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184927 predicted 2138
2 SASI_Rn01_00184928 predicted 842
3 SASI_Rn01_00184929 predicted 2230
4 SASI_Rn01_00184930 predicted 564
5 SASI_Rn01_00184931 predicted 1710
6 SASI_Rn01_00184932 predicted 1297
7 SASI_Rn01_00184933 predicted 1529
8 SASI_Rn01_00184934 predicted 776
9 SASI_Rn01_00184935 predicted 2130
10 SASI_Rn01_00184936 predicted 2213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172120 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115355 predicted 1189
2 SASI_Mm01_00115356 predicted 2126
3 SASI_Mm01_00115357 predicted 838
4 SASI_Mm01_00115358 predicted 2228
5 SASI_Mm01_00115359 predicted 1185
6 SASI_Mm01_00115360 predicted 2125
7 SASI_Mm01_00115361 predicted 2368
8 SASI_Mm01_00115362 predicted 958
9 SASI_Mm01_00115363 predicted 2181
10 SASI_Mm01_00115364 predicted 1630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014396
VALIDATED
VPS41 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 41 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-2134s1c1
Sequence:CCGGCCATTGACAAACCACCATTTACTCGAGTAAATGGTGGTTTGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-208s1c1
Sequence:CCGGGCACACATTATGGCAAGGTTTCTCGAGAAACCTTGCCATAATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-1899s1c1
Sequence:CCGGCGACCAAACTTACTTCCCTTTCTCGAGAAAGGGAAGTAAGTTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-987s1c1
Sequence:CCGGGCTTTGACAGTCAGAGGCTTTCTCGAGAAAGCCTCTGACTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-788s1c1
Sequence:CCGGGCCAAGTCGATATGTTGAAATCTCGAGATTTCAACATATCGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014396.3-573s21c1
Sequence:CCGGCTGATTGCTTGGGCCAATAATCTCGAGATTATTGGCCCAAGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014396.3-987s21c1
Sequence:CCGGGCTTTGACAGTCAGAGGCTTTCTCGAGAAAGCCTCTGACTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014396.3-788s21c1
Sequence:CCGGGCCAAGTCGATATGTTGAAATCTCGAGATTTCAACATATCGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014396.3-2134s21c1
Sequence:CCGGCCATTGACAAACCACCATTTACTCGAGTAAATGGTGGTTTGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014396.3-2723s21c1
Sequence:CCGGTCATCTATTCCTGTACTAATGCTCGAGCATTAGTACAGGAATAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014396.3-1648s21c1
Sequence:GTACCGGAGTTGATCCACAAGCATAATCCTCGAGGATTATGCTTGTGGATCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014396
VALIDATED
VPS41 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 41 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-2134s1c1
Sequence:CCGGCCATTGACAAACCACCATTTACTCGAGTAAATGGTGGTTTGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-208s1c1
Sequence:CCGGGCACACATTATGGCAAGGTTTCTCGAGAAACCTTGCCATAATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-1899s1c1
Sequence:CCGGCGACCAAACTTACTTCCCTTTCTCGAGAAAGGGAAGTAAGTTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-987s1c1
Sequence:CCGGGCTTTGACAGTCAGAGGCTTTCTCGAGAAAGCCTCTGACTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-788s1c1
Sequence:CCGGGCCAAGTCGATATGTTGAAATCTCGAGATTTCAACATATCGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014396.3-573s21c1
Sequence:CCGGCTGATTGCTTGGGCCAATAATCTCGAGATTATTGGCCCAAGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014396.3-987s21c1
Sequence:CCGGGCTTTGACAGTCAGAGGCTTTCTCGAGAAAGCCTCTGACTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014396.3-788s21c1
Sequence:CCGGGCCAAGTCGATATGTTGAAATCTCGAGATTTCAACATATCGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014396.3-2134s21c1
Sequence:CCGGCCATTGACAAACCACCATTTACTCGAGTAAATGGTGGTTTGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014396.3-2723s21c1
Sequence:CCGGTCATCTATTCCTGTACTAATGCTCGAGCATTAGTACAGGAATAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014396.3-1648s21c1
Sequence:GTACCGGAGTTGATCCACAAGCATAATCCTCGAGGATTATGCTTGTGGATCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014396
VALIDATED
VPS41 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 41 homolog (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-2134s1c1
Sequence:CCGGCCATTGACAAACCACCATTTACTCGAGTAAATGGTGGTTTGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-208s1c1
Sequence:CCGGGCACACATTATGGCAAGGTTTCTCGAGAAACCTTGCCATAATGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-1899s1c1
Sequence:CCGGCGACCAAACTTACTTCCCTTTCTCGAGAAAGGGAAGTAAGTTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-987s1c1
Sequence:CCGGGCTTTGACAGTCAGAGGCTTTCTCGAGAAAGCCTCTGACTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014396.2-788s1c1
Sequence:CCGGGCCAAGTCGATATGTTGAAATCTCGAGATTTCAACATATCGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014396.3-573s21c1
Sequence:CCGGCTGATTGCTTGGGCCAATAATCTCGAGATTATTGGCCCAAGCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014396.3-987s21c1
Sequence:CCGGGCTTTGACAGTCAGAGGCTTTCTCGAGAAAGCCTCTGACTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014396.3-788s21c1
Sequence:CCGGGCCAAGTCGATATGTTGAAATCTCGAGATTTCAACATATCGACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014396.3-2134s21c1
Sequence:CCGGCCATTGACAAACCACCATTTACTCGAGTAAATGGTGGTTTGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014396.3-2723s21c1
Sequence:CCGGTCATCTATTCCTGTACTAATGCTCGAGCATTAGTACAGGAATAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014396.3-1648s21c1
Sequence:GTACCGGAGTTGATCCACAAGCATAATCCTCGAGGATTATGCTTGTGGATCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172120
VALIDATED
VPS41 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 41 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-2760s1c1
Sequence:CCGGGCTCTTCCCATGCCATGAAATCTCGAGATTTCATGGCATGGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-1187s1c1
Sequence:CCGGCGACATAAGATTCTGGATATTCTCGAGAATATCCAGAATCTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-1388s1c1
Sequence:CCGGCCACTCATCTATGAAATGATTCTCGAGAATCATTTCATAGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-266s1c1
Sequence:CCGGCCTGTGAAGATAAACCAAATTCTCGAGAATTTGGTTTATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172120.2-2197s1c1
Sequence:CCGGCCACCGAATTAAGGAAGGAATCTCGAGATTCCTTCCTTAATTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172120.3-2123s21c1
Sequence:CCGGCATCGACAAACCACCATTTATCTCGAGATAAATGGTGGTTTGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-2186s21c1
Sequence:CCGGTCTACTTATCCACCGAATTAACTCGAGTTAATTCGGTGGATAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-2758s21c1
Sequence:CCGGGCTCTTCCCATGCCATGAAATCTCGAGATTTCATGGCATGGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-1185s21c1
Sequence:CCGGCGACATAAGATTCTGGATATTCTCGAGAATATCCAGAATCTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-264s21c1
Sequence:CCGGCCTGTGAAGATAAACCAAATTCTCGAGAATTTGGTTTATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-1458s21c1
Sequence:CCGGGAGTGGCCTGGAGATCTATATCTCGAGATATAGATCTCCAGGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172120
VALIDATED
VPS41 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 41 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-2760s1c1
Sequence:CCGGGCTCTTCCCATGCCATGAAATCTCGAGATTTCATGGCATGGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-1187s1c1
Sequence:CCGGCGACATAAGATTCTGGATATTCTCGAGAATATCCAGAATCTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-1388s1c1
Sequence:CCGGCCACTCATCTATGAAATGATTCTCGAGAATCATTTCATAGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-266s1c1
Sequence:CCGGCCTGTGAAGATAAACCAAATTCTCGAGAATTTGGTTTATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172120.2-2197s1c1
Sequence:CCGGCCACCGAATTAAGGAAGGAATCTCGAGATTCCTTCCTTAATTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172120.3-2123s21c1
Sequence:CCGGCATCGACAAACCACCATTTATCTCGAGATAAATGGTGGTTTGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-2186s21c1
Sequence:CCGGTCTACTTATCCACCGAATTAACTCGAGTTAATTCGGTGGATAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-2758s21c1
Sequence:CCGGGCTCTTCCCATGCCATGAAATCTCGAGATTTCATGGCATGGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-1185s21c1
Sequence:CCGGCGACATAAGATTCTGGATATTCTCGAGAATATCCAGAATCTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-264s21c1
Sequence:CCGGCCTGTGAAGATAAACCAAATTCTCGAGAATTTGGTTTATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-1458s21c1
Sequence:CCGGGAGTGGCCTGGAGATCTATATCTCGAGATATAGATCTCCAGGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172120
VALIDATED
VPS41 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 41 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-2760s1c1
Sequence:CCGGGCTCTTCCCATGCCATGAAATCTCGAGATTTCATGGCATGGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-1187s1c1
Sequence:CCGGCGACATAAGATTCTGGATATTCTCGAGAATATCCAGAATCTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-1388s1c1
Sequence:CCGGCCACTCATCTATGAAATGATTCTCGAGAATCATTTCATAGATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172120.2-266s1c1
Sequence:CCGGCCTGTGAAGATAAACCAAATTCTCGAGAATTTGGTTTATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172120.2-2197s1c1
Sequence:CCGGCCACCGAATTAAGGAAGGAATCTCGAGATTCCTTCCTTAATTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172120.3-2123s21c1
Sequence:CCGGCATCGACAAACCACCATTTATCTCGAGATAAATGGTGGTTTGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-2186s21c1
Sequence:CCGGTCTACTTATCCACCGAATTAACTCGAGTTAATTCGGTGGATAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-2758s21c1
Sequence:CCGGGCTCTTCCCATGCCATGAAATCTCGAGATTTCATGGCATGGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-1185s21c1
Sequence:CCGGCGACATAAGATTCTGGATATTCTCGAGAATATCCAGAATCTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-264s21c1
Sequence:CCGGCCTGTGAAGATAAACCAAATTCTCGAGAATTTGGTTTATCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_172120.3-1458s21c1
Sequence:CCGGGAGTGGCCTGGAGATCTATATCTCGAGATATAGATCTCCAGGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks