EMAIL THIS PAGE TO A FRIEND

VPS45

vacuolar protein sorting 45 homolog (S. cerevisiae)

Synonyms: H1 H1VPS45 SCN5 VPS45A VPS45B VPS54A VSP45 VSP45A
UniProtKB ID: Q9NRW7, D3DUZ9, Q15715, Q5T4P6, Q9Y4Z6
Gene ID:
Human(11311) Summary: Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec1 domain family, and shows a high degree of sequence similarity to mouse, rat and yeast Vps45. The exact function of this gene is not known, but its high expression in peripheral blood mononuclear cells suggests a role in trafficking proteins, including inflammatory mediators. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2013]
Mouse(22365) vacuolar protein sorting 45 (yeast)
Rat(64516) vacuolar protein sorting 45 homolog (S. cerevisiae)
cow(541230) vacuolar protein sorting 45 homolog (S. cerevisiae)
sheep(101102352) vacuolar protein sorting 45 homolog (S. cerevisiae)
naked mole-rat(101714653) vacuolar protein sorting 45 homolog (S. cerevisiae)
domestic guinea pig(100723595) vacuolar protein sorting 45 homolog (S. cerevisiae)
fruit fly(41153) Vacuolar protein sorting 45
domestic cat(101082077) vacuolar protein sorting 45 homolog (S. cerevisiae)
Horse(100054447) vacuolar protein sorting 45 homolog (S. cerevisiae)
dog(475833) vacuolar protein sorting 45 homolog (S. cerevisiae)
chicken(430741) vacuolar protein sorting 45 homolog (S. cerevisiae)
Thale Cress(844050) vacuolar protein sorting 45
Zebrafish(561653) vacuolar protein sorting 45 homolog (S. cerevisiae)
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007259 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007258 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007259 Rosetta Predictions human pricing
NM_172072 Rosetta Predictions rat pricing
NM_013841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165616 predicted 1486
2 SASI_Hs01_00165617 predicted 748
3 SASI_Hs01_00165618 predicted 631
4 SASI_Hs01_00165620 predicted 1281
5 SASI_Hs01_00165621 predicted 1166
6 SASI_Hs01_00165622 predicted 1324
7 SASI_Hs01_00165623 predicted 1785
8 SASI_Hs01_00165625 predicted 748
9 SASI_Hs02_00343281 predicted 2109
10 SASI_Hs02_00343282 predicted 1293
11 SASI_Hs01_00165619 predicted 2119
12 SASI_Hs01_00165624 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078405 predicted 1277
2 SASI_Rn02_00269172 predicted 1217
3 SASI_Rn01_00078406 predicted 885
4 SASI_Rn01_00078407 predicted 1578
5 SASI_Rn01_00078408 predicted 562
6 SASI_Rn01_00078409 predicted 1375
7 SASI_Rn01_00078410 predicted 623
8 SASI_Rn01_00078411 predicted 808
9 SASI_Rn01_00078412 predicted 1341
10 SASI_Rn01_00078413 predicted 518
11 SASI_Rn01_00078414 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107466 predicted 1536
2 SASI_Mm01_00107467 predicted 1755
3 SASI_Mm01_00107468 predicted 834
4 SASI_Mm01_00107469 predicted 1724
5 SASI_Mm01_00107470 predicted 1450
6 SASI_Mm01_00107472 predicted 1830
7 SASI_Mm01_00107474 predicted 1381
8 SASI_Mm01_00107475 predicted 1291
9 SASI_Mm02_00322840 predicted 1405
10 SASI_Mm02_00322841 predicted 1775
11 SASI_Mm01_00107471 predicted 930
12 SASI_Mm01_00107473 predicted 1983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007259
VPS45 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 45 homolog (S. cerevisiae)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1281s21c1
Sequence:CCGGCCACGAACTACTAGGCATAAACTCGAGTTTATGCCTAGTAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1001s21c1
Sequence:CCGGGTTGCTGCCAGGGTCGAAATTCTCGAGAATTTCGACCCTGGCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-670s21c1
Sequence:CCGGGGCATAGTGAGTATGGTATACCTCGAGGTATACCATACTCACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007259.3-2446s21c1
Sequence:CCGGCCCAGAGTTGTCCTAACAATACTCGAGTATTGTTAGGACAACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1664s21c1
Sequence:CCGGCTAGTGCTCTCCAGAATATAACTCGAGTTATATTCTGGAGAGCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1144s21c1
Sequence:CCGGGTTAAGCAAGTGATAACTAAACTCGAGTTTAGTTATCACTTGCTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007259
VPS45 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 45 homolog (S. cerevisiae)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1281s21c1
Sequence:CCGGCCACGAACTACTAGGCATAAACTCGAGTTTATGCCTAGTAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1001s21c1
Sequence:CCGGGTTGCTGCCAGGGTCGAAATTCTCGAGAATTTCGACCCTGGCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-670s21c1
Sequence:CCGGGGCATAGTGAGTATGGTATACCTCGAGGTATACCATACTCACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007259.3-2446s21c1
Sequence:CCGGCCCAGAGTTGTCCTAACAATACTCGAGTATTGTTAGGACAACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1664s21c1
Sequence:CCGGCTAGTGCTCTCCAGAATATAACTCGAGTTATATTCTGGAGAGCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1144s21c1
Sequence:CCGGGTTAAGCAAGTGATAACTAAACTCGAGTTTAGTTATCACTTGCTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007259
VPS45 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 45 homolog (S. cerevisiae)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1281s21c1
Sequence:CCGGCCACGAACTACTAGGCATAAACTCGAGTTTATGCCTAGTAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1001s21c1
Sequence:CCGGGTTGCTGCCAGGGTCGAAATTCTCGAGAATTTCGACCCTGGCAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-670s21c1
Sequence:CCGGGGCATAGTGAGTATGGTATACCTCGAGGTATACCATACTCACTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007259.3-2446s21c1
Sequence:CCGGCCCAGAGTTGTCCTAACAATACTCGAGTATTGTTAGGACAACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1664s21c1
Sequence:CCGGCTAGTGCTCTCCAGAATATAACTCGAGTTATATTCTGGAGAGCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007259.3-1144s21c1
Sequence:CCGGGTTAAGCAAGTGATAACTAAACTCGAGTTTAGTTATCACTTGCTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013841
VALIDATED
VPS45 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 45 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-1372s21c1
Sequence:CCGGCTGCTCAACCAGTGGACATATCTCGAGATATGTCCACTGGTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013841.2-2431s21c1
Sequence:CCGGGAATGTCATGGCCTCCTCTTACTCGAGTAAGAGGAGGCCATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-1538s21c1
Sequence:CCGGCCGAGATTGGTAGCAATATAACTCGAGTTATATTGCTACCAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-2191s21c1
Sequence:CCGGCCTCAGGATATCATCGTGTTTCTCGAGAAACACGATGATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-1087s21c1
Sequence:CCGGGCGGTGAATCCACATTTGTTTCTCGAGAAACAAATGTGGATTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013841.1-2431s1c1
Sequence:CCGGGAATGTCATGGCCTCCTCTTACTCGAGTAAGAGGAGGCCATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013841.1-1087s1c1
Sequence:CCGGGCGGTGAATCCACATTTGTTTCTCGAGAAACAAATGTGGATTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013841.1-2191s1c1
Sequence:CCGGCCTCAGGATATCATCGTGTTTCTCGAGAAACACGATGATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013841.1-1372s1c1
Sequence:CCGGCTGCTCAACCAGTGGACATATCTCGAGATATGTCCACTGGTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013841.1-1538s1c1
Sequence:CCGGCCGAGATTGGTAGCAATATAACTCGAGTTATATTGCTACCAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013841
VALIDATED
VPS45 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 45 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-1372s21c1
Sequence:CCGGCTGCTCAACCAGTGGACATATCTCGAGATATGTCCACTGGTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013841.2-2431s21c1
Sequence:CCGGGAATGTCATGGCCTCCTCTTACTCGAGTAAGAGGAGGCCATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-1538s21c1
Sequence:CCGGCCGAGATTGGTAGCAATATAACTCGAGTTATATTGCTACCAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-2191s21c1
Sequence:CCGGCCTCAGGATATCATCGTGTTTCTCGAGAAACACGATGATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-1087s21c1
Sequence:CCGGGCGGTGAATCCACATTTGTTTCTCGAGAAACAAATGTGGATTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013841.1-2431s1c1
Sequence:CCGGGAATGTCATGGCCTCCTCTTACTCGAGTAAGAGGAGGCCATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013841.1-1087s1c1
Sequence:CCGGGCGGTGAATCCACATTTGTTTCTCGAGAAACAAATGTGGATTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013841.1-2191s1c1
Sequence:CCGGCCTCAGGATATCATCGTGTTTCTCGAGAAACACGATGATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013841.1-1372s1c1
Sequence:CCGGCTGCTCAACCAGTGGACATATCTCGAGATATGTCCACTGGTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013841.1-1538s1c1
Sequence:CCGGCCGAGATTGGTAGCAATATAACTCGAGTTATATTGCTACCAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013841
VALIDATED
VPS45 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 45 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-1372s21c1
Sequence:CCGGCTGCTCAACCAGTGGACATATCTCGAGATATGTCCACTGGTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013841.2-2431s21c1
Sequence:CCGGGAATGTCATGGCCTCCTCTTACTCGAGTAAGAGGAGGCCATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-1538s21c1
Sequence:CCGGCCGAGATTGGTAGCAATATAACTCGAGTTATATTGCTACCAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-2191s21c1
Sequence:CCGGCCTCAGGATATCATCGTGTTTCTCGAGAAACACGATGATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013841.2-1087s21c1
Sequence:CCGGGCGGTGAATCCACATTTGTTTCTCGAGAAACAAATGTGGATTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013841.1-2431s1c1
Sequence:CCGGGAATGTCATGGCCTCCTCTTACTCGAGTAAGAGGAGGCCATGACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013841.1-1087s1c1
Sequence:CCGGGCGGTGAATCCACATTTGTTTCTCGAGAAACAAATGTGGATTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013841.1-2191s1c1
Sequence:CCGGCCTCAGGATATCATCGTGTTTCTCGAGAAACACGATGATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013841.1-1372s1c1
Sequence:CCGGCTGCTCAACCAGTGGACATATCTCGAGATATGTCCACTGGTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013841.1-1538s1c1
Sequence:CCGGCCGAGATTGGTAGCAATATAACTCGAGTTATATTGCTACCAATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007258
VALIDATED
VPS45 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 45 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-302s1c1
Sequence:CCGGCGAAGACCCAAGTATAGCATACTCGAGTATGCTATACTTGGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007258.1-1593s1c1
Sequence:CCGGCAGTCTATAACCTCAACCGTACTCGAGTACGGTTGAGGTTATAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007258.1-100s1c1
Sequence:CCGGGCCTGGTATGAAAGTACTTCTCTCGAGAGAAGTACTTTCATACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007258.1-239s1c1
Sequence:CCGGCTGAAGGCAATTTGTTTCCTTCTCGAGAAGGAAACAAATTGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-1541s1c1
Sequence:CCGGCAGGACATCATCGTGTTCGTTCTCGAGAACGAACACGATGATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-346s1c1
Sequence:CCGGGATCAGCAAGAGTGACGTGAACTCGAGTTCACGTCACTCTTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007258.1-799s1c1
Sequence:CCGGGCCAGGAATCAGCAAAGACTTCTCGAGAAGTCTTTGCTGATTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-256s1c1
Sequence:CCGGCCTTCGACCTACAAAGGAGAACTCGAGTTCTCCTTTGTAGGTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007258
VALIDATED
VPS45 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 45 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-302s1c1
Sequence:CCGGCGAAGACCCAAGTATAGCATACTCGAGTATGCTATACTTGGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007258.1-1593s1c1
Sequence:CCGGCAGTCTATAACCTCAACCGTACTCGAGTACGGTTGAGGTTATAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007258.1-100s1c1
Sequence:CCGGGCCTGGTATGAAAGTACTTCTCTCGAGAGAAGTACTTTCATACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007258.1-239s1c1
Sequence:CCGGCTGAAGGCAATTTGTTTCCTTCTCGAGAAGGAAACAAATTGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-1541s1c1
Sequence:CCGGCAGGACATCATCGTGTTCGTTCTCGAGAACGAACACGATGATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-346s1c1
Sequence:CCGGGATCAGCAAGAGTGACGTGAACTCGAGTTCACGTCACTCTTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007258.1-799s1c1
Sequence:CCGGGCCAGGAATCAGCAAAGACTTCTCGAGAAGTCTTTGCTGATTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-256s1c1
Sequence:CCGGCCTTCGACCTACAAAGGAGAACTCGAGTTCTCCTTTGTAGGTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007258
VALIDATED
VPS45 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 45 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-302s1c1
Sequence:CCGGCGAAGACCCAAGTATAGCATACTCGAGTATGCTATACTTGGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007258.1-1593s1c1
Sequence:CCGGCAGTCTATAACCTCAACCGTACTCGAGTACGGTTGAGGTTATAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007258.1-100s1c1
Sequence:CCGGGCCTGGTATGAAAGTACTTCTCTCGAGAGAAGTACTTTCATACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007258.1-239s1c1
Sequence:CCGGCTGAAGGCAATTTGTTTCCTTCTCGAGAAGGAAACAAATTGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-1541s1c1
Sequence:CCGGCAGGACATCATCGTGTTCGTTCTCGAGAACGAACACGATGATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-346s1c1
Sequence:CCGGGATCAGCAAGAGTGACGTGAACTCGAGTTCACGTCACTCTTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007258.1-799s1c1
Sequence:CCGGGCCAGGAATCAGCAAAGACTTCTCGAGAAGTCTTTGCTGATTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007258.1-256s1c1
Sequence:CCGGCCTTCGACCTACAAAGGAGAACTCGAGTTCTCCTTTGTAGGTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks