EMAIL THIS PAGE TO A FRIEND

VPS4A

vacuolar protein sorting 4 homolog A (S. cerevisiae)

Synonyms: SKD1 SKD1A SKD2 VPS4 VPS4-1
UniProtKB ID: Q9UN37, B2RCB7, Q8TF07, Q9UI03, Q9Y582
Gene ID:
Human(27183) Summary: The protein encoded by this gene is a member of the AAA protein family (ATPases associated with diverse cellular activities), and is the homolog of the yeast Vps4 protein. In humans, two paralogs of the yeast protein have been identified. The former share a high degree of aa sequence similarity with each other, and also with yeast Vps4 and mouse Skd1 proteins. The mouse Skd1 (suppressor of K+ transport defect 1) has been shown to be really an yeast Vps4 ortholog. Functional studies indicate that both human paralogs associate with the endosomal compartments, and are involved in intracellular protein trafficking, similar to Vps4 protein in yeast. The gene encoding this paralog has been mapped to chromosome 16; the gene for the other resides on chromosome 18. [provided by RefSeq, Jul 2008]
Mouse(116733) vacuolar protein sorting 4a (yeast)
Rat(246772) vacuolar protein sorting 4 homolog A (S. cerevisiae)
Zebrafish(767670) vacuolar protein sorting 4a (yeast)
domestic cat(101082613) vacuolar protein sorting 4 homolog A (S. cerevisiae)
dog(479674) vacuolar protein sorting 4 homolog A (S. cerevisiae)
chicken(425637) vacuolar protein sorting 4 homolog A (S. cerevisiae)
domestic guinea pig(100724580) vacuolar protein sorting 4 homolog A (S. cerevisiae)
naked mole-rat(101716007) vacuolar protein sorting 4 homolog A (S. cerevisiae)
Domestic Rabbit(100340140) vacuolar protein sorting 4 homolog A (S. cerevisiae)
cow(618168) vacuolar protein sorting 4 homolog A (S. cerevisiae)
sheep(101112669) vacuolar protein sorting 4 homolog A (S. cerevisiae)
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013245 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_126165 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_126165 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_126165 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013245 Rosetta Predictions human pricing
NM_145678 Rosetta Predictions rat pricing
NM_126165 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139689 predicted 529
2 SASI_Hs01_00139690 predicted 1326
3 SASI_Hs01_00139691 predicted 1377
4 SASI_Hs01_00139692 predicted 786
5 SASI_Hs01_00139693 predicted 541
6 SASI_Hs01_00139694 predicted 296
7 SASI_Hs01_00139695 predicted 531
8 SASI_Hs02_00344453 predicted 1307
9 SASI_Hs01_00139696 predicted 463
10 SASI_Hs01_00139697 predicted 865
11 SASI_Hs01_00139698 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064714 predicted 1087
2 SASI_Rn01_00064715 predicted 257
3 SASI_Rn01_00064716 predicted 738
4 SASI_Rn01_00064717 predicted 538
5 SASI_Rn01_00064718 predicted 1059
6 SASI_Rn01_00064719 predicted 904
7 SASI_Rn01_00064720 predicted 371
8 SASI_Rn01_00064721 predicted 464
9 SASI_Rn01_00064722 predicted 366
10 SASI_Rn02_00268732 predicted 392
11 SASI_Rn01_00064713 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_126165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112004 predicted 514
2 SASI_Mm01_00112005 predicted 692
3 SASI_Mm01_00112006 predicted 1435
4 SASI_Mm01_00112008 predicted 1435
5 SASI_Mm01_00112009 predicted 575
6 SASI_Mm02_00338240 predicted 885
7 SASI_Mm01_00112010 predicted 556
8 SASI_Mm01_00112011 predicted 1332
9 SASI_Mm02_00338241 predicted 1192
10 SASI_Mm01_00112013 predicted 1043
11 SASI_Mm01_00112007 predicted 1556
12 SASI_Mm01_00112012 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013245
VALIDATED
VPS4A MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 4 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013245.2-245s1c1
Sequence:CCGGCCTCCACGCTATCAAGTATGACTCGAGTCATACTTGATAGCGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013245.2-329s1c1
Sequence:CCGGCGAGAAGCTGAAGGATTATTTCTCGAGAAATAATCCTTCAGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013245.2-355s1c1
Sequence:CCGGGCAAAGAGAAACACGGCAAGACTCGAGTCTTGCCGTGTTTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013245.2-2031s1c1
Sequence:CCGGGTGTCGTTTAGATCAGGGTAACTCGAGTTACCCTGATCTAAACGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013245.2-378s1c1
Sequence:CCGGCCAGTCAAAGAGAACCAGAGTCTCGAGACTCTGGTTCTCTTTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013245.2-327s1c1
Sequence:CCGGGCCGAGAAGCTGAAGGATTATCTCGAGATAATCCTTCAGCTTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013245.2-244s21c1
Sequence:CCGGTCCTCCACGCTATCAAGTATGCTCGAGCATACTTGATAGCGTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_013245.2-2031s21c1
Sequence:CCGGGTGTCGTTTAGATCAGGGTAACTCGAGTTACCCTGATCTAAACGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_013245.2-355s21c1
Sequence:CCGGGCAAAGAGAAACACGGCAAGACTCGAGTCTTGCCGTGTTTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013245.2-329s21c1
Sequence:CCGGCGAGAAGCTGAAGGATTATTTCTCGAGAAATAATCCTTCAGCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013245
VALIDATED
VPS4A MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 4 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013245.2-245s1c1
Sequence:CCGGCCTCCACGCTATCAAGTATGACTCGAGTCATACTTGATAGCGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013245.2-329s1c1
Sequence:CCGGCGAGAAGCTGAAGGATTATTTCTCGAGAAATAATCCTTCAGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013245.2-355s1c1
Sequence:CCGGGCAAAGAGAAACACGGCAAGACTCGAGTCTTGCCGTGTTTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013245.2-2031s1c1
Sequence:CCGGGTGTCGTTTAGATCAGGGTAACTCGAGTTACCCTGATCTAAACGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013245.2-378s1c1
Sequence:CCGGCCAGTCAAAGAGAACCAGAGTCTCGAGACTCTGGTTCTCTTTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013245.2-327s1c1
Sequence:CCGGGCCGAGAAGCTGAAGGATTATCTCGAGATAATCCTTCAGCTTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013245.2-244s21c1
Sequence:CCGGTCCTCCACGCTATCAAGTATGCTCGAGCATACTTGATAGCGTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_013245.2-2031s21c1
Sequence:CCGGGTGTCGTTTAGATCAGGGTAACTCGAGTTACCCTGATCTAAACGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_013245.2-355s21c1
Sequence:CCGGGCAAAGAGAAACACGGCAAGACTCGAGTCTTGCCGTGTTTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013245.2-329s21c1
Sequence:CCGGCGAGAAGCTGAAGGATTATTTCTCGAGAAATAATCCTTCAGCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013245
VALIDATED
VPS4A MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 4 homolog A (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013245.2-245s1c1
Sequence:CCGGCCTCCACGCTATCAAGTATGACTCGAGTCATACTTGATAGCGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013245.2-329s1c1
Sequence:CCGGCGAGAAGCTGAAGGATTATTTCTCGAGAAATAATCCTTCAGCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013245.2-355s1c1
Sequence:CCGGGCAAAGAGAAACACGGCAAGACTCGAGTCTTGCCGTGTTTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013245.2-2031s1c1
Sequence:CCGGGTGTCGTTTAGATCAGGGTAACTCGAGTTACCCTGATCTAAACGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013245.2-378s1c1
Sequence:CCGGCCAGTCAAAGAGAACCAGAGTCTCGAGACTCTGGTTCTCTTTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013245.2-327s1c1
Sequence:CCGGGCCGAGAAGCTGAAGGATTATCTCGAGATAATCCTTCAGCTTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013245.2-244s21c1
Sequence:CCGGTCCTCCACGCTATCAAGTATGCTCGAGCATACTTGATAGCGTGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_013245.2-2031s21c1
Sequence:CCGGGTGTCGTTTAGATCAGGGTAACTCGAGTTACCCTGATCTAAACGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_013245.2-355s21c1
Sequence:CCGGGCAAAGAGAAACACGGCAAGACTCGAGTCTTGCCGTGTTTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013245.2-329s21c1
Sequence:CCGGCGAGAAGCTGAAGGATTATTTCTCGAGAAATAATCCTTCAGCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_126165
VALIDATED
VPS4A MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 4 homolog A (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-1827s1c1
Sequence:CCGGGCCTCTTAACTTTGGCTACTTCTCGAGAAGTAGCCAAAGTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-580s1c1
Sequence:CCGGGCCAATTAAATTCCCACACTTCTCGAGAAGTGTGGGAATTTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-352s1c1
Sequence:CCGGGCTGAAGGATTATTTACGAAACTCGAGTTTCGTAAATAATCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-1411s1c1
Sequence:CCGGCCTCCTGAAAGTAAAGAAATTCTCGAGAATTTCTTTACTTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-1040s1c1
Sequence:CCGGCGTGCCCAAATGTTTCGGTTACTCGAGTAACCGAAACATTTGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-1846s21c1
Sequence:GTACCGGTTGTGAGCTGACTGTGGTAAACTCGAGTTTACCACAGTCAGCTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_126165.1-1815s21c1
Sequence:GTACCGGCTTTCACTCCTTGCCTCTTAACTCGAGTTAAGAGGCAAGGAGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-498s21c1
Sequence:CCGGTGATGGAGAAGCCGAACATACCTCGAGGTATGTTCGGCTTCTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126165.1-1411s21c1
Sequence:CCGGCCTCCTGAAAGTAAAGAAATTCTCGAGAATTTCTTTACTTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126165.1-352s21c1
Sequence:CCGGGCTGAAGGATTATTTACGAAACTCGAGTTTCGTAAATAATCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-1542s21c1
Sequence:CCGGAGTCGTGAAGTCAATAGTATTCTCGAGAATACTATTGACTTCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-1231s21c1
Sequence:CCGGTCGAACCAACCCTAGCGTTATCTCGAGATAACGCTAGGGTTGGTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_126165
VALIDATED
VPS4A MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 4 homolog A (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-1827s1c1
Sequence:CCGGGCCTCTTAACTTTGGCTACTTCTCGAGAAGTAGCCAAAGTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-580s1c1
Sequence:CCGGGCCAATTAAATTCCCACACTTCTCGAGAAGTGTGGGAATTTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-352s1c1
Sequence:CCGGGCTGAAGGATTATTTACGAAACTCGAGTTTCGTAAATAATCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-1411s1c1
Sequence:CCGGCCTCCTGAAAGTAAAGAAATTCTCGAGAATTTCTTTACTTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-1040s1c1
Sequence:CCGGCGTGCCCAAATGTTTCGGTTACTCGAGTAACCGAAACATTTGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-1846s21c1
Sequence:GTACCGGTTGTGAGCTGACTGTGGTAAACTCGAGTTTACCACAGTCAGCTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_126165.1-1815s21c1
Sequence:GTACCGGCTTTCACTCCTTGCCTCTTAACTCGAGTTAAGAGGCAAGGAGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-498s21c1
Sequence:CCGGTGATGGAGAAGCCGAACATACCTCGAGGTATGTTCGGCTTCTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126165.1-1411s21c1
Sequence:CCGGCCTCCTGAAAGTAAAGAAATTCTCGAGAATTTCTTTACTTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126165.1-352s21c1
Sequence:CCGGGCTGAAGGATTATTTACGAAACTCGAGTTTCGTAAATAATCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-1542s21c1
Sequence:CCGGAGTCGTGAAGTCAATAGTATTCTCGAGAATACTATTGACTTCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-1231s21c1
Sequence:CCGGTCGAACCAACCCTAGCGTTATCTCGAGATAACGCTAGGGTTGGTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_126165
VALIDATED
VPS4A MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 4 homolog A (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-1827s1c1
Sequence:CCGGGCCTCTTAACTTTGGCTACTTCTCGAGAAGTAGCCAAAGTTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-580s1c1
Sequence:CCGGGCCAATTAAATTCCCACACTTCTCGAGAAGTGTGGGAATTTAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-352s1c1
Sequence:CCGGGCTGAAGGATTATTTACGAAACTCGAGTTTCGTAAATAATCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-1411s1c1
Sequence:CCGGCCTCCTGAAAGTAAAGAAATTCTCGAGAATTTCTTTACTTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_126165.1-1040s1c1
Sequence:CCGGCGTGCCCAAATGTTTCGGTTACTCGAGTAACCGAAACATTTGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-1846s21c1
Sequence:GTACCGGTTGTGAGCTGACTGTGGTAAACTCGAGTTTACCACAGTCAGCTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_126165.1-1815s21c1
Sequence:GTACCGGCTTTCACTCCTTGCCTCTTAACTCGAGTTAAGAGGCAAGGAGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-498s21c1
Sequence:CCGGTGATGGAGAAGCCGAACATACCTCGAGGTATGTTCGGCTTCTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126165.1-1411s21c1
Sequence:CCGGCCTCCTGAAAGTAAAGAAATTCTCGAGAATTTCTTTACTTTCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126165.1-352s21c1
Sequence:CCGGGCTGAAGGATTATTTACGAAACTCGAGTTTCGTAAATAATCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-1542s21c1
Sequence:CCGGAGTCGTGAAGTCAATAGTATTCTCGAGAATACTATTGACTTCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_126165.1-1231s21c1
Sequence:CCGGTCGAACCAACCCTAGCGTTATCTCGAGATAACGCTAGGGTTGGTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks