EMAIL THIS PAGE TO A FRIEND

VPS4B

vacuolar protein sorting 4 homolog B (S. cerevisiae)

Synonyms: SKD1 SKD1B VPS4-2
UniProtKB ID: O75351, Q69HW4, Q9GZS7
Gene ID:
Human(9525) Summary: The protein encoded by this gene is a member of the AAA protein family (ATPases associated with diverse cellular activities), and is the homolog of the yeast Vps4 protein. In humans, two paralogs of the yeast protein have been identified. The former share a high degree of aa sequence similarity with each other, and also with yeast Vps4 and mouse Skd1 proteins. Mouse Skd1 (suppressor of K+ transport defect 1) has been shown to be a yeast Vps4 ortholog. Functional studies indicate that both human paralogs associate with the endosomal compartments, and are involved in intracellular protein trafficking, similar to Vps4 protein in yeast. The gene encoding this paralog has been mapped to chromosome 18; the gene for the other resides on chromosome 16. [provided by RefSeq, Jul 2008]
Mouse(20479) vacuolar protein sorting 4b (yeast)
Rat(360834) vacuolar protein sorting 4 homolog B (S. cerevisiae)
cow(539357) vacuolar protein sorting 4 homolog B (S. cerevisiae)
sheep(101103111) vacuolar protein sorting 4 homolog B (S. cerevisiae)
Domestic Rabbit(100338152) vacuolar protein sorting 4 homolog B (S. cerevisiae)
naked mole-rat(101702359) vacuolar protein sorting 4 homolog B (S. cerevisiae)
domestic guinea pig(100730380) vacuolar protein sorting 4 homolog B (S. cerevisiae)
Zebrafish(393880) vacuolar protein sorting 4b (yeast)
dog(607306) vacuolar protein sorting 4 homolog B (S. cerevisiae)
domestic cat(101083116) vacuolar protein sorting 4 homolog B (S. cerevisiae)
dog(476178) vacuolar protein sorting 4 homolog B (S. cerevisiae)
chicken(420901) vacuolar protein sorting 4 homolog B (S. cerevisiae)
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009190 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009190 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009190 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004869 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004869 Rosetta Predictions human pricing
NM_001025716 Rosetta Predictions rat pricing
NM_009190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196511 predicted 1470
2 SASI_Hs01_00196513 predicted 1492
3 SASI_Hs01_00196514 predicted 290
4 SASI_Hs01_00196515 predicted 1423
5 SASI_Hs01_00196516 predicted 622
6 SASI_Hs01_00196517 predicted 1648
7 SASI_Hs01_00196518 predicted 1299
8 SASI_Hs01_00196519 predicted 415
9 SASI_Hs01_00196520 predicted 1580
10 SASI_Hs02_00338494 predicted 714
11 SASI_Hs01_00196512 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054014 predicted 1228
2 SASI_Rn01_00054015 predicted 643
3 SASI_Rn01_00054016 predicted 1533
4 SASI_Rn01_00054017 predicted 1064
5 SASI_Rn01_00054018 predicted 1036
6 SASI_Rn01_00054019 predicted 358
7 SASI_Rn01_00054020 predicted 731
8 SASI_Rn01_00054021 predicted 1354
9 SASI_Rn01_00054022 predicted 565
10 SASI_Rn01_00054023 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077385 predicted 1319
2 SASI_Mm01_00077386 predicted 1446
3 SASI_Mm02_00315563 predicted 740
4 SASI_Mm01_00077387 predicted 711
5 SASI_Mm01_00077388 predicted 1154
6 SASI_Mm01_00077389 predicted 1622
7 SASI_Mm01_00077390 predicted 931
8 SASI_Mm01_00077391 predicted 1391
9 SASI_Mm01_00077392 predicted 646
10 SASI_Mm01_00077393 predicted 784
11 SASI_Mm01_00077394 predicted 691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009190
VALIDATED
VPS4B MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 4 homolog B (S. cerevisiae)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009190.2-1343s21c1
Sequence:GTACCGGAGTTCAGTCAGCTACTCACTTCTCGAGAAGTGAGTAGCTGACTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009190.2-1600s21c1
Sequence:GTACCGGGCCAGGAAGGCTAACACAAAGCTCGAGCTTTGTGTTAGCCTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009190.2-2082s21c1
Sequence:CCGGACGCAGAGCACTGATGAATTTCTCGAGAAATTCATCAGTGCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1022s21c1
Sequence:CCGGCGAGGCTGCACGGAGAATTAACTCGAGTTAATTCTCCGTGCAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1537s21c1
Sequence:CCGGGCACAAAGCCAACAGTCAATGCTCGAGCATTGACTGTTGGCTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1389s21c1
Sequence:CCGGGCTGATCCTAACTGCATTGTACTCGAGTACAATGCAGTTAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1145s21c1
Sequence:CCGGGCGAAGATTTGAGAAACGTATCTCGAGATACGTTTCTCAAATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009190.1-2630s1c1
Sequence:CCGGCCTGCAAACAATTACTAGGTTCTCGAGAACCTAGTAATTGTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-662s1c1
Sequence:CCGGGCTCTTAAAGAGGCTGTGATTCTCGAGAATCACAGCCTCTTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-1096s1c1
Sequence:CCGGGCGAAGATTTGAGAAACGTATCTCGAGATACGTTTCTCAAATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-1340s1c1
Sequence:CCGGGCTGATCCTAACTGCATTGTACTCGAGTACAATGCAGTTAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-1448s1c1
Sequence:CCGGCCAGTTGTTTCCATGTGGGATCTCGAGATCCCACATGGAAACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009190
VALIDATED
VPS4B MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 4 homolog B (S. cerevisiae)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009190.2-1343s21c1
Sequence:GTACCGGAGTTCAGTCAGCTACTCACTTCTCGAGAAGTGAGTAGCTGACTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009190.2-1600s21c1
Sequence:GTACCGGGCCAGGAAGGCTAACACAAAGCTCGAGCTTTGTGTTAGCCTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009190.2-2082s21c1
Sequence:CCGGACGCAGAGCACTGATGAATTTCTCGAGAAATTCATCAGTGCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1022s21c1
Sequence:CCGGCGAGGCTGCACGGAGAATTAACTCGAGTTAATTCTCCGTGCAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1537s21c1
Sequence:CCGGGCACAAAGCCAACAGTCAATGCTCGAGCATTGACTGTTGGCTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1389s21c1
Sequence:CCGGGCTGATCCTAACTGCATTGTACTCGAGTACAATGCAGTTAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1145s21c1
Sequence:CCGGGCGAAGATTTGAGAAACGTATCTCGAGATACGTTTCTCAAATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009190.1-2630s1c1
Sequence:CCGGCCTGCAAACAATTACTAGGTTCTCGAGAACCTAGTAATTGTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-662s1c1
Sequence:CCGGGCTCTTAAAGAGGCTGTGATTCTCGAGAATCACAGCCTCTTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-1096s1c1
Sequence:CCGGGCGAAGATTTGAGAAACGTATCTCGAGATACGTTTCTCAAATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-1340s1c1
Sequence:CCGGGCTGATCCTAACTGCATTGTACTCGAGTACAATGCAGTTAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-1448s1c1
Sequence:CCGGCCAGTTGTTTCCATGTGGGATCTCGAGATCCCACATGGAAACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009190
VALIDATED
VPS4B MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 4 homolog B (S. cerevisiae)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009190.2-1343s21c1
Sequence:GTACCGGAGTTCAGTCAGCTACTCACTTCTCGAGAAGTGAGTAGCTGACTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009190.2-1600s21c1
Sequence:GTACCGGGCCAGGAAGGCTAACACAAAGCTCGAGCTTTGTGTTAGCCTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009190.2-2082s21c1
Sequence:CCGGACGCAGAGCACTGATGAATTTCTCGAGAAATTCATCAGTGCTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1022s21c1
Sequence:CCGGCGAGGCTGCACGGAGAATTAACTCGAGTTAATTCTCCGTGCAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1537s21c1
Sequence:CCGGGCACAAAGCCAACAGTCAATGCTCGAGCATTGACTGTTGGCTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1389s21c1
Sequence:CCGGGCTGATCCTAACTGCATTGTACTCGAGTACAATGCAGTTAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009190.2-1145s21c1
Sequence:CCGGGCGAAGATTTGAGAAACGTATCTCGAGATACGTTTCTCAAATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009190.1-2630s1c1
Sequence:CCGGCCTGCAAACAATTACTAGGTTCTCGAGAACCTAGTAATTGTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-662s1c1
Sequence:CCGGGCTCTTAAAGAGGCTGTGATTCTCGAGAATCACAGCCTCTTTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-1096s1c1
Sequence:CCGGGCGAAGATTTGAGAAACGTATCTCGAGATACGTTTCTCAAATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-1340s1c1
Sequence:CCGGGCTGATCCTAACTGCATTGTACTCGAGTACAATGCAGTTAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009190.1-1448s1c1
Sequence:CCGGCCAGTTGTTTCCATGTGGGATCTCGAGATCCCACATGGAAACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004869
VALIDATED
VPS4B MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 4 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-828s21c1
Sequence:GTACCGGGAAGCCAACAACTCAACATTTCTCGAGAAATGTTGAGTTGTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-1816s21c1
Sequence:CCGGGCGATATATGAACGGCATAAACTCGAGTTTATGCCGTTCATATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-1325s21c1
Sequence:CCGGAGTACAGTCAGCTACTCATTTCTCGAGAAATGAGTAGCTGACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-704s21c1
Sequence:CCGGGGCTGTGATACTGCCTATTAACTCGAGTTAATAGGCAGTATCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-1003s21c1
Sequence:CCGGGTGAAGCCGCACGTAGAATTACTCGAGTAATTCTACGTGCGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004869.2-1446s1c1
Sequence:CCGGGCGGTCACTATCTAACACAAACTCGAGTTTGTGTTAGATAGTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004869.2-634s1c1
Sequence:CCGGGCACTGAAAGAGGCTGTGATACTCGAGTATCACAGCCTCTTTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_004869.2-1069s1c1
Sequence:CCGGCGAAGATTTGAGAAACGAATTCTCGAGAATTCGTTTCTCAAATCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004869.2-569s1c1
Sequence:CCGGCCATTGTTATAGAACGACCAACTCGAGTTGGTCGTTCTATAACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004869.2-1312s1c1
Sequence:CCGGGCTGATCCTAACCATCTTGTACTCGAGTACAAGATGGTTAGGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004869
VALIDATED
VPS4B MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 4 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-828s21c1
Sequence:GTACCGGGAAGCCAACAACTCAACATTTCTCGAGAAATGTTGAGTTGTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-1816s21c1
Sequence:CCGGGCGATATATGAACGGCATAAACTCGAGTTTATGCCGTTCATATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-1325s21c1
Sequence:CCGGAGTACAGTCAGCTACTCATTTCTCGAGAAATGAGTAGCTGACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-704s21c1
Sequence:CCGGGGCTGTGATACTGCCTATTAACTCGAGTTAATAGGCAGTATCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-1003s21c1
Sequence:CCGGGTGAAGCCGCACGTAGAATTACTCGAGTAATTCTACGTGCGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004869.2-1446s1c1
Sequence:CCGGGCGGTCACTATCTAACACAAACTCGAGTTTGTGTTAGATAGTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004869.2-634s1c1
Sequence:CCGGGCACTGAAAGAGGCTGTGATACTCGAGTATCACAGCCTCTTTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_004869.2-1069s1c1
Sequence:CCGGCGAAGATTTGAGAAACGAATTCTCGAGAATTCGTTTCTCAAATCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004869.2-569s1c1
Sequence:CCGGCCATTGTTATAGAACGACCAACTCGAGTTGGTCGTTCTATAACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004869.2-1312s1c1
Sequence:CCGGGCTGATCCTAACCATCTTGTACTCGAGTACAAGATGGTTAGGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004869
VALIDATED
VPS4B MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 4 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-828s21c1
Sequence:GTACCGGGAAGCCAACAACTCAACATTTCTCGAGAAATGTTGAGTTGTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-1816s21c1
Sequence:CCGGGCGATATATGAACGGCATAAACTCGAGTTTATGCCGTTCATATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-1325s21c1
Sequence:CCGGAGTACAGTCAGCTACTCATTTCTCGAGAAATGAGTAGCTGACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-704s21c1
Sequence:CCGGGGCTGTGATACTGCCTATTAACTCGAGTTAATAGGCAGTATCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004869.3-1003s21c1
Sequence:CCGGGTGAAGCCGCACGTAGAATTACTCGAGTAATTCTACGTGCGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004869.2-1446s1c1
Sequence:CCGGGCGGTCACTATCTAACACAAACTCGAGTTTGTGTTAGATAGTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004869.2-634s1c1
Sequence:CCGGGCACTGAAAGAGGCTGTGATACTCGAGTATCACAGCCTCTTTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_004869.2-1069s1c1
Sequence:CCGGCGAAGATTTGAGAAACGAATTCTCGAGAATTCGTTTCTCAAATCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004869.2-569s1c1
Sequence:CCGGCCATTGTTATAGAACGACCAACTCGAGTTGGTCGTTCTATAACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004869.2-1312s1c1
Sequence:CCGGGCTGATCCTAACCATCTTGTACTCGAGTACAAGATGGTTAGGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks