EMAIL THIS PAGE TO A FRIEND

VPS51

vacuolar protein sorting 51 homolog (S. cerevisiae)

Synonyms: ANG2 ANG3 C11orf2 C11orf3 FFR
UniProtKB ID: Q9UID3, Q6PJV5, Q7L8A6, Q8WZ35, Q96DF4, Q96GR3
Gene ID:
Human(738) Summary: This gene encodes a member of the vacuolar protein sorting-associated protein 51 family. The encoded protein is a component of the Golgi-associated retrograde protein complex which acts as a tethering factor for carriers in retrograde transport from the early and late endosomes to the trans-Golgi network. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(68505) vacuolar protein sorting 51 homolog (S. cerevisiae)
Rat(100361915) vacuolar protein sorting 51 homolog (S. cerevisiae)
Zebrafish(559339) vacuolar protein sorting 51 homolog (S. cerevisiae)
domestic cat(101096167) vacuolar protein sorting 51 homolog (S. cerevisiae)
dog(476028) vacuolar protein sorting 51 homolog (S. cerevisiae)
domestic guinea pig(100722707) vacuolar protein sorting 51 homolog (S. cerevisiae)
naked mole-rat(101700187) vacuolar protein sorting 51 homolog (S. cerevisiae)
cow(525567) vacuolar protein sorting 51 homolog (S. cerevisiae)
sheep(101120711) vacuolar protein sorting 51 homolog (S. cerevisiae)
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081041 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081041 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081041 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019771 MISSION® esiRNA esiRNA human C11orf2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013265 Rosetta Predictions human pricing
NM_001081041 Rosetta Predictions mouse pricing
XM_001004854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088814 predicted 234
2 SASI_Hs01_00088815 predicted 2048
3 SASI_Hs01_00088816 predicted 1762
4 SASI_Hs01_00088817 predicted 2284
5 SASI_Hs01_00088818 predicted 478
6 SASI_Hs01_00088819 predicted 1851
7 SASI_Hs01_00088820 predicted 406
8 SASI_Hs02_00344491 predicted 386
9 SASI_Hs01_00088822 predicted 1760
10 SASI_Hs01_00088823 predicted 2218
11 SASI_Hs01_00088821 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294601 predicted 2026
2 SASI_Mm02_00294602 predicted 1730
3 SASI_Mm02_00294603 predicted 2318
4 SASI_Mm02_00294604 predicted 2019
5 SASI_Mm02_00294605 predicted 1819
6 SASI_Mm02_00294606 predicted 2215
7 SASI_Mm02_00294607 predicted 440
8 SASI_Mm02_00294608 predicted 2110
9 SASI_Mm02_00294609 predicted 1195
10 SASI_Mm02_00294610 predicted 2122
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206858 predicted 1744
2 SASI_Mm01_00206859 predicted 2327
3 SASI_Mm01_00206860 predicted 2023
4 SASI_Mm01_00206861 predicted 1828
5 SASI_Mm01_00206862 predicted 2212
6 SASI_Mm01_00206863 predicted 450
7 SASI_Mm01_00206864 predicted 2112
8 SASI_Mm01_00206865 predicted 1197
9 SASI_Mm01_00206866 predicted 333
10 SASI_Mm01_00206867 predicted 1685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013265
VALIDATED
VPS51 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 51 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-1792s1c1
Sequence:CCGGCCTGGTCATATCACAGATGCTCTCGAGAGCATCTGTGATATGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-1972s1c1
Sequence:CCGGCAAGAGGACTTTCTCCGTGTACTCGAGTACACGGAGAAAGTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-406s1c1
Sequence:CCGGCCGGAAGATGAAGAACGATTTCTCGAGAAATCGTTCTTCATCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013265.2-1669s1c1
Sequence:CCGGCACTCTCACTGATGAACAGTTCTCGAGAACTGTTCATCAGTGAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-2077s1c1
Sequence:CCGGGAAGCTATTCTCTGAACGTATCTCGAGATACGTTCAGAGAATAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-415s1c1
Sequence:CCGGGAAGAACGATTTCCGGAAGATCTCGAGATCTTCCGGAAATCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-142s1c1
Sequence:CCGGCGGGATGCTGAAGCTTTACTACTCGAGTAGTAAAGCTTCAGCATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-247s1c1
Sequence:CCGGCCCGGAAGTTTACCTAGACAACTCGAGTTGTCTAGGTAAACTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-1447s1c1
Sequence:CCGGCAAAGAGGTGTCCTTCTCCAACTCGAGTTGGAGAAGGACACCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-1682s1c1
Sequence:CCGGGAACAGTTTCTGGTGCAGGATCTCGAGATCCTGCACCAGAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-938s1c1
Sequence:CCGGGTGTTAGAGTTCACCGACCATCTCGAGATGGTCGGTGAACTCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-406s21c1
Sequence:CCGGCCGGAAGATGAAGAACGATTTCTCGAGAAATCGTTCTTCATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-938s21c1
Sequence:CCGGGTGTTAGAGTTCACCGACCATCTCGAGATGGTCGGTGAACTCTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-2077s21c1
Sequence:CCGGGAAGCTATTCTCTGAACGTATCTCGAGATACGTTCAGAGAATAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-1972s21c1
Sequence:CCGGCAAGAGGACTTTCTCCGTGTACTCGAGTACACGGAGAAAGTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013265
VALIDATED
VPS51 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 51 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-1792s1c1
Sequence:CCGGCCTGGTCATATCACAGATGCTCTCGAGAGCATCTGTGATATGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-1972s1c1
Sequence:CCGGCAAGAGGACTTTCTCCGTGTACTCGAGTACACGGAGAAAGTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-406s1c1
Sequence:CCGGCCGGAAGATGAAGAACGATTTCTCGAGAAATCGTTCTTCATCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013265.2-1669s1c1
Sequence:CCGGCACTCTCACTGATGAACAGTTCTCGAGAACTGTTCATCAGTGAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-2077s1c1
Sequence:CCGGGAAGCTATTCTCTGAACGTATCTCGAGATACGTTCAGAGAATAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-415s1c1
Sequence:CCGGGAAGAACGATTTCCGGAAGATCTCGAGATCTTCCGGAAATCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-142s1c1
Sequence:CCGGCGGGATGCTGAAGCTTTACTACTCGAGTAGTAAAGCTTCAGCATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-247s1c1
Sequence:CCGGCCCGGAAGTTTACCTAGACAACTCGAGTTGTCTAGGTAAACTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-1447s1c1
Sequence:CCGGCAAAGAGGTGTCCTTCTCCAACTCGAGTTGGAGAAGGACACCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-1682s1c1
Sequence:CCGGGAACAGTTTCTGGTGCAGGATCTCGAGATCCTGCACCAGAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-938s1c1
Sequence:CCGGGTGTTAGAGTTCACCGACCATCTCGAGATGGTCGGTGAACTCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-406s21c1
Sequence:CCGGCCGGAAGATGAAGAACGATTTCTCGAGAAATCGTTCTTCATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-938s21c1
Sequence:CCGGGTGTTAGAGTTCACCGACCATCTCGAGATGGTCGGTGAACTCTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-2077s21c1
Sequence:CCGGGAAGCTATTCTCTGAACGTATCTCGAGATACGTTCAGAGAATAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-1972s21c1
Sequence:CCGGCAAGAGGACTTTCTCCGTGTACTCGAGTACACGGAGAAAGTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013265
VALIDATED
VPS51 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 51 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-1792s1c1
Sequence:CCGGCCTGGTCATATCACAGATGCTCTCGAGAGCATCTGTGATATGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-1972s1c1
Sequence:CCGGCAAGAGGACTTTCTCCGTGTACTCGAGTACACGGAGAAAGTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-406s1c1
Sequence:CCGGCCGGAAGATGAAGAACGATTTCTCGAGAAATCGTTCTTCATCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013265.2-1669s1c1
Sequence:CCGGCACTCTCACTGATGAACAGTTCTCGAGAACTGTTCATCAGTGAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-2077s1c1
Sequence:CCGGGAAGCTATTCTCTGAACGTATCTCGAGATACGTTCAGAGAATAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-415s1c1
Sequence:CCGGGAAGAACGATTTCCGGAAGATCTCGAGATCTTCCGGAAATCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-142s1c1
Sequence:CCGGCGGGATGCTGAAGCTTTACTACTCGAGTAGTAAAGCTTCAGCATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-247s1c1
Sequence:CCGGCCCGGAAGTTTACCTAGACAACTCGAGTTGTCTAGGTAAACTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-1447s1c1
Sequence:CCGGCAAAGAGGTGTCCTTCTCCAACTCGAGTTGGAGAAGGACACCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013265.2-1682s1c1
Sequence:CCGGGAACAGTTTCTGGTGCAGGATCTCGAGATCCTGCACCAGAAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013265.2-938s1c1
Sequence:CCGGGTGTTAGAGTTCACCGACCATCTCGAGATGGTCGGTGAACTCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-406s21c1
Sequence:CCGGCCGGAAGATGAAGAACGATTTCTCGAGAAATCGTTCTTCATCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-938s21c1
Sequence:CCGGGTGTTAGAGTTCACCGACCATCTCGAGATGGTCGGTGAACTCTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-2077s21c1
Sequence:CCGGGAAGCTATTCTCTGAACGTATCTCGAGATACGTTCAGAGAATAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013265.2-1972s21c1
Sequence:CCGGCAAGAGGACTTTCTCCGTGTACTCGAGTACACGGAGAAAGTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081041
VALIDATED
VPS51 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 51 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-1859s21c1
Sequence:CCGGTGGAGGACACTACAGCTATTGCTCGAGCAATAGCTGTAGTGTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-109s21c1
Sequence:CCGGCACGGGATGCTGAAGCTTTACCTCGAGGTAAAGCTTCAGCATCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081041.1-2103s21c1
Sequence:CCGGGGTGCTGACTGGCATCATTAACTCGAGTTAATGATGCCAGTCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-1591s21c1
Sequence:CCGGTCTCGCCTCTGCCTGGATTATCTCGAGATAATCCAGGCAGAGGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-2443s21c1
Sequence:CCGGGGGTTCATGGATCCTTCTAATCTCGAGATTAGAAGGATCCATGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081041
VALIDATED
VPS51 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 51 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-1859s21c1
Sequence:CCGGTGGAGGACACTACAGCTATTGCTCGAGCAATAGCTGTAGTGTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-109s21c1
Sequence:CCGGCACGGGATGCTGAAGCTTTACCTCGAGGTAAAGCTTCAGCATCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081041.1-2103s21c1
Sequence:CCGGGGTGCTGACTGGCATCATTAACTCGAGTTAATGATGCCAGTCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-1591s21c1
Sequence:CCGGTCTCGCCTCTGCCTGGATTATCTCGAGATAATCCAGGCAGAGGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-2443s21c1
Sequence:CCGGGGGTTCATGGATCCTTCTAATCTCGAGATTAGAAGGATCCATGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081041
VALIDATED
VPS51 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 51 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-1859s21c1
Sequence:CCGGTGGAGGACACTACAGCTATTGCTCGAGCAATAGCTGTAGTGTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-109s21c1
Sequence:CCGGCACGGGATGCTGAAGCTTTACCTCGAGGTAAAGCTTCAGCATCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081041.1-2103s21c1
Sequence:CCGGGGTGCTGACTGGCATCATTAACTCGAGTTAATGATGCCAGTCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-1591s21c1
Sequence:CCGGTCTCGCCTCTGCCTGGATTATCTCGAGATAATCCAGGCAGAGGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081041.1-2443s21c1
Sequence:CCGGGGGTTCATGGATCCTTCTAATCTCGAGATTAGAAGGATCCATGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks