EMAIL THIS PAGE TO A FRIEND

VPS52

vacuolar protein sorting 52 homolog (S. cerevisiae)

Synonyms: ARE1 RP5-1033B10 SAC2 SACM2L dJ1033B10.5
Gene ID:
Human(6293) Summary: This gene encodes a protein that is similar to the yeast suppressor of actin mutations 2 gene. The yeast protein forms a subunit of the tetrameric Golgi-associated retrograde protein complex that is involved in vesicle trafficking from from both early and late endosomes, back to the trans-Golgi network. This gene is located on chromosome 6 in a head-to-head orientation with the gene encoding ribosomal protein S18. [provided by RefSeq, Jul 2008]
Mouse(224705) vacuolar protein sorting 52 (yeast)
Rat(25218) vacuolar protein sorting 52 homolog (S. cerevisiae)
cow(511364) vacuolar protein sorting 52 homolog (S. cerevisiae)
sheep(101116872) vacuolar protein sorting 52 homolog (S. cerevisiae)
naked mole-rat(101722763) vacuolar protein sorting 52 homolog (S. cerevisiae)
domestic guinea pig(100732125) vacuolar protein sorting 52 homolog (S. cerevisiae)
Zebrafish(556724) vacuolar protein sorting 52 (yeast)
Horse(100052599) vacuolar protein sorting 52 homolog (S. cerevisiae)
domestic cat(101086807) vacuolar protein sorting 52 homolog (S. cerevisiae)
dog(474871) vacuolar protein sorting 52 homolog (S. cerevisiae)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172620 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172620 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172620 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022553 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022553 Rosetta Predictions human pricing
NM_033097 Rosetta Predictions rat pricing
NM_172620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017924 predicted 492
2 SASI_Hs01_00017925 predicted 2334
3 SASI_Hs01_00017926 predicted 1187
4 SASI_Hs01_00017927 predicted 439
5 SASI_Hs02_00355828 predicted 1862
6 SASI_Hs01_00017928 predicted 1093
7 SASI_Hs01_00017929 predicted 413
8 SASI_Hs01_00017930 predicted 1161
9 SASI_Hs01_00017931 predicted 1478
10 SASI_Hs02_00355829 predicted 2144
11 SASI_Hs01_00017932 predicted 525
12 SASI_Hs01_00017933 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065490 predicted 871
2 SASI_Rn01_00065491 predicted 1166
3 SASI_Rn01_00065493 predicted 1149
4 SASI_Rn01_00065495 predicted 272
5 SASI_Rn01_00065496 predicted 1743
6 SASI_Rn01_00065497 predicted 970
7 SASI_Rn01_00065498 predicted 243
8 SASI_Rn01_00065499 predicted 982
9 SASI_Rn02_00265504 predicted 946
10 SASI_Rn02_00265505 predicted 955
11 SASI_Rn01_00065492 predicted 233
12 SASI_Rn01_00065494 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344328 predicted 1892
2 SASI_Mm01_00115535 predicted 927
3 SASI_Mm01_00115536 predicted 505
4 SASI_Mm01_00115538 predicted 1954
5 SASI_Mm01_00115539 predicted 1378
6 SASI_Mm01_00115540 predicted 616
7 SASI_Mm01_00115541 predicted 912
8 SASI_Mm01_00115542 predicted 908
9 SASI_Mm01_00115543 predicted 1232
10 SASI_Mm01_00115544 predicted 1723
11 SASI_Mm01_00115537 predicted 1439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172620
VPS52 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 52 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-534s21c1
Sequence:GTACCGGACATAGCGTCTCTGCACAATCCTCGAGGATTGTGCAGAGACGCTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-1368s21c1
Sequence:GTACCGGACTATGCCCTCCTCGACAATTCTCGAGAATTGTCGAGGAGGGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-915s21c1
Sequence:GTACCGGTGACGAAGATCCGGGAGTTTACTCGAGTAAACTCCCGGATCTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-1560s21c1
Sequence:GTACCGGTTCTCCGGTTCCGCAACATTGCTCGAGCAATGTTGCGGAACCGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-442s21c1
Sequence:GTACCGGTGTGGATCTTCGACACTATTCCTCGAGGAATAGTGTCGAAGATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-498s21c1
Sequence:GTACCGGAGAAGTCAATCCGGGACTATACTCGAGTATAGTCCCGGATTGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172620.1-2886s1c1
Sequence:CCGGCATGTGTTTATTGTAGACCTACTCGAGTAGGTCTACAATAAACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-2427s1c1
Sequence:CCGGGCTGAAGAAACACAAGCCGAACTCGAGTTCGGCTTGTGTTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-1171s1c1
Sequence:CCGGCTGTCCTACTACCGATCCTATCTCGAGATAGGATCGGTAGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-512s1c1
Sequence:CCGGGTGTGGATCTTCGACACTATTCTCGAGAATAGTGTCGAAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-2252s1c1
Sequence:CCGGGTCAGGATGTAATGCGAAGTTCTCGAGAACTTCGCATTACATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172620
VPS52 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 52 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-534s21c1
Sequence:GTACCGGACATAGCGTCTCTGCACAATCCTCGAGGATTGTGCAGAGACGCTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-1368s21c1
Sequence:GTACCGGACTATGCCCTCCTCGACAATTCTCGAGAATTGTCGAGGAGGGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-915s21c1
Sequence:GTACCGGTGACGAAGATCCGGGAGTTTACTCGAGTAAACTCCCGGATCTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-1560s21c1
Sequence:GTACCGGTTCTCCGGTTCCGCAACATTGCTCGAGCAATGTTGCGGAACCGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-442s21c1
Sequence:GTACCGGTGTGGATCTTCGACACTATTCCTCGAGGAATAGTGTCGAAGATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-498s21c1
Sequence:GTACCGGAGAAGTCAATCCGGGACTATACTCGAGTATAGTCCCGGATTGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172620.1-2886s1c1
Sequence:CCGGCATGTGTTTATTGTAGACCTACTCGAGTAGGTCTACAATAAACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-2427s1c1
Sequence:CCGGGCTGAAGAAACACAAGCCGAACTCGAGTTCGGCTTGTGTTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-1171s1c1
Sequence:CCGGCTGTCCTACTACCGATCCTATCTCGAGATAGGATCGGTAGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-512s1c1
Sequence:CCGGGTGTGGATCTTCGACACTATTCTCGAGAATAGTGTCGAAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-2252s1c1
Sequence:CCGGGTCAGGATGTAATGCGAAGTTCTCGAGAACTTCGCATTACATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172620
VPS52 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 52 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-534s21c1
Sequence:GTACCGGACATAGCGTCTCTGCACAATCCTCGAGGATTGTGCAGAGACGCTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-1368s21c1
Sequence:GTACCGGACTATGCCCTCCTCGACAATTCTCGAGAATTGTCGAGGAGGGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-915s21c1
Sequence:GTACCGGTGACGAAGATCCGGGAGTTTACTCGAGTAAACTCCCGGATCTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-1560s21c1
Sequence:GTACCGGTTCTCCGGTTCCGCAACATTGCTCGAGCAATGTTGCGGAACCGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-442s21c1
Sequence:GTACCGGTGTGGATCTTCGACACTATTCCTCGAGGAATAGTGTCGAAGATCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172620.3-498s21c1
Sequence:GTACCGGAGAAGTCAATCCGGGACTATACTCGAGTATAGTCCCGGATTGACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172620.1-2886s1c1
Sequence:CCGGCATGTGTTTATTGTAGACCTACTCGAGTAGGTCTACAATAAACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-2427s1c1
Sequence:CCGGGCTGAAGAAACACAAGCCGAACTCGAGTTCGGCTTGTGTTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-1171s1c1
Sequence:CCGGCTGTCCTACTACCGATCCTATCTCGAGATAGGATCGGTAGTAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-512s1c1
Sequence:CCGGGTGTGGATCTTCGACACTATTCTCGAGAATAGTGTCGAAGATCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172620.1-2252s1c1
Sequence:CCGGGTCAGGATGTAATGCGAAGTTCTCGAGAACTTCGCATTACATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022553
VALIDATED
VPS52 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 52 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-440s21c1
Sequence:CCGGGTGTAGATCTCCGTCACTATTCTCGAGAATAGTGACGGAGATCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-1367s21c1
Sequence:CCGGACTACGCCCTCCTAGACAATTCTCGAGAATTGTCTAGGAGGGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-1007s21c1
Sequence:GTACCGGACAGGTTCTTCTATCAGTTTCCTCGAGGAAACTGATAGAAGAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-2527s21c1
Sequence:CCGGGCACCTTGCCCAACAGGATAACTCGAGTTATCCTGTTGGGCAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-914s21c1
Sequence:CCGGTGACGAAGATCCGAGAGTTTACTCGAGTAAACTCTCGGATCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022553.3-1571s1c1
Sequence:CCGGCACTATATCACACGCCGCTATCTCGAGATAGCGGCGTGTGATATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_022553.3-2404s1c1
Sequence:CCGGGCCTTCTGAATATCCCAGTGTCTCGAGACACTGGGATATTCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-2277s1c1
Sequence:CCGGCCCATTCCATACCCTTCTTCACTCGAGTGAAGAAGGGTATGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-1732s1c1
Sequence:CCGGGCTTGTGTTTCTGATCAACAACTCGAGTTGTTGATCAGAAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-530s1c1
Sequence:CCGGCAGAAATCCATTCGGGATTATCTCGAGATAATCCCGAATGGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-2469s1c1
Sequence:CCGGCCTTTATCATTTCTCCAGTCTCTCGAGAGACTGGAGAAATGATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-485s1c1
Sequence:CCGGCGTCACTATTCAAAGCAAGTTCTCGAGAACTTGCTTTGAATAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_022553.3-1983s1c1
Sequence:CCGGGCTTTGGTAGTTCCTGGAAATCTCGAGATTTCCAGGAACTACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022553.3-1033s1c1
Sequence:CCGGGCTGAAGTACAGGTTCTTCTACTCGAGTAGAAGAACCTGTACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022553.3-1995s1c1
Sequence:CCGGCCTGGAAATCATCAGTGGAATCTCGAGATTCCACTGATGATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022553
VALIDATED
VPS52 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 52 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-440s21c1
Sequence:CCGGGTGTAGATCTCCGTCACTATTCTCGAGAATAGTGACGGAGATCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-1367s21c1
Sequence:CCGGACTACGCCCTCCTAGACAATTCTCGAGAATTGTCTAGGAGGGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-1007s21c1
Sequence:GTACCGGACAGGTTCTTCTATCAGTTTCCTCGAGGAAACTGATAGAAGAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-2527s21c1
Sequence:CCGGGCACCTTGCCCAACAGGATAACTCGAGTTATCCTGTTGGGCAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-914s21c1
Sequence:CCGGTGACGAAGATCCGAGAGTTTACTCGAGTAAACTCTCGGATCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022553.3-1571s1c1
Sequence:CCGGCACTATATCACACGCCGCTATCTCGAGATAGCGGCGTGTGATATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_022553.3-2404s1c1
Sequence:CCGGGCCTTCTGAATATCCCAGTGTCTCGAGACACTGGGATATTCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-2277s1c1
Sequence:CCGGCCCATTCCATACCCTTCTTCACTCGAGTGAAGAAGGGTATGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-1732s1c1
Sequence:CCGGGCTTGTGTTTCTGATCAACAACTCGAGTTGTTGATCAGAAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-530s1c1
Sequence:CCGGCAGAAATCCATTCGGGATTATCTCGAGATAATCCCGAATGGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-2469s1c1
Sequence:CCGGCCTTTATCATTTCTCCAGTCTCTCGAGAGACTGGAGAAATGATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-485s1c1
Sequence:CCGGCGTCACTATTCAAAGCAAGTTCTCGAGAACTTGCTTTGAATAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_022553.3-1983s1c1
Sequence:CCGGGCTTTGGTAGTTCCTGGAAATCTCGAGATTTCCAGGAACTACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022553.3-1033s1c1
Sequence:CCGGGCTGAAGTACAGGTTCTTCTACTCGAGTAGAAGAACCTGTACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022553.3-1995s1c1
Sequence:CCGGCCTGGAAATCATCAGTGGAATCTCGAGATTCCACTGATGATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022553
VALIDATED
VPS52 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 52 homolog (S. cerevisiae)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-440s21c1
Sequence:CCGGGTGTAGATCTCCGTCACTATTCTCGAGAATAGTGACGGAGATCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-1367s21c1
Sequence:CCGGACTACGCCCTCCTAGACAATTCTCGAGAATTGTCTAGGAGGGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-1007s21c1
Sequence:GTACCGGACAGGTTCTTCTATCAGTTTCCTCGAGGAAACTGATAGAAGAACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-2527s21c1
Sequence:CCGGGCACCTTGCCCAACAGGATAACTCGAGTTATCCTGTTGGGCAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022553.4-914s21c1
Sequence:CCGGTGACGAAGATCCGAGAGTTTACTCGAGTAAACTCTCGGATCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022553.3-1571s1c1
Sequence:CCGGCACTATATCACACGCCGCTATCTCGAGATAGCGGCGTGTGATATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_022553.3-2404s1c1
Sequence:CCGGGCCTTCTGAATATCCCAGTGTCTCGAGACACTGGGATATTCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-2277s1c1
Sequence:CCGGCCCATTCCATACCCTTCTTCACTCGAGTGAAGAAGGGTATGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-1732s1c1
Sequence:CCGGGCTTGTGTTTCTGATCAACAACTCGAGTTGTTGATCAGAAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-530s1c1
Sequence:CCGGCAGAAATCCATTCGGGATTATCTCGAGATAATCCCGAATGGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151767    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-2469s1c1
Sequence:CCGGCCTTTATCATTTCTCCAGTCTCTCGAGAGACTGGAGAAATGATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022553.3-485s1c1
Sequence:CCGGCGTCACTATTCAAAGCAAGTTCTCGAGAACTTGCTTTGAATAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_022553.3-1983s1c1
Sequence:CCGGGCTTTGGTAGTTCCTGGAAATCTCGAGATTTCCAGGAACTACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022553.3-1033s1c1
Sequence:CCGGGCTGAAGTACAGGTTCTTCTACTCGAGTAGAAGAACCTGTACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022553.3-1995s1c1
Sequence:CCGGCCTGGAAATCATCAGTGGAATCTCGAGATTCCACTGATGATTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks