EMAIL THIS PAGE TO A FRIEND

VPS53

vacuolar protein sorting 53 homolog (S. cerevisiae)

Synonyms: HCCS1 hVps53L pp13624
Gene ID:
Human(55275) Summary: This gene encodes a protein with sequence similarity to the yeast Vps53p protein. Vps53p is involved in retrograde vesicle trafficking in late Golgi. [provided by RefSeq, Jul 2008]
Mouse(68299) vacuolar protein sorting 53 (yeast)
Rat(287535) vacuolar protein sorting 53 homolog (S. cerevisiae)
Zebrafish(492817) vacuolar protein sorting 53 homolog (S. cerevisiae)
chicken(417622) vacuolar protein sorting 53 homolog (S. cerevisiae)
dog(491188) vacuolar protein sorting 53 homolog (S. cerevisiae)
domestic cat(101087363) vacuolar protein sorting 53 homolog (S. cerevisiae)
Horse(100059934) vacuolar protein sorting 53 homolog (S. cerevisiae)
domestic guinea pig(100714671) vacuolar protein sorting 53 homolog (S. cerevisiae)
naked mole-rat(101714565) vacuolar protein sorting 53 homolog (S. cerevisiae)
Domestic Rabbit(100344854) vacuolar protein sorting 53 homolog (S. cerevisiae)
cow(512144) vacuolar protein sorting 53 homolog (S. cerevisiae)
sheep(101114625) vacuolar protein sorting 53 homolog (S. cerevisiae)
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018289 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128159 Rosetta Predictions human pricing
NM_018289 Rosetta Predictions human pricing
NM_001105813 Rosetta Predictions rat pricing
NM_026664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330616 predicted 505
2 SASI_Hs02_00330617 predicted 310
3 SASI_Hs02_00330618 predicted 530
4 SASI_Hs02_00330619 predicted 2380
5 SASI_Hs02_00330620 predicted 1942
6 SASI_Hs02_00330621 predicted 540
7 SASI_Hs02_00330622 predicted 245
8 SASI_Hs02_00330623 predicted 313
9 SASI_Hs02_00330624 predicted 261
10 SASI_Hs02_00330625 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150815 predicted 220
2 SASI_Hs02_00351673 predicted 1254
3 SASI_Hs01_00150817 predicted 692
4 SASI_Hs02_00351674 predicted 1170
5 SASI_Hs01_00150818 predicted 354
6 SASI_Hs01_00150820 predicted 1767
7 SASI_Hs01_00150821 predicted 363
8 SASI_Hs01_00150822 predicted 232
9 SASI_Hs01_00150823 predicted 1551
10 SASI_Hs01_00150824 predicted 1007
11 SASI_Hs01_00150816 predicted 1226
12 SASI_Hs01_00150819 predicted 1968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212786 predicted 506
2 SASI_Rn02_00212787 predicted 2042
3 SASI_Rn02_00212788 predicted 373
4 SASI_Rn02_00212789 predicted 633
5 SASI_Rn02_00212790 predicted 2363
6 SASI_Rn02_00212791 predicted 653
7 SASI_Rn02_00212792 predicted 292
8 SASI_Rn02_00212793 predicted 304
9 SASI_Rn02_00212794 predicted 1029
10 SASI_Rn02_00212795 predicted 2027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330653 predicted 2374
2 SASI_Mm01_00088429 predicted 1331
3 SASI_Mm01_00088430 predicted 631
4 SASI_Mm02_00330654 predicted 1610
5 SASI_Mm02_00330655 predicted 2406
6 SASI_Mm01_00088434 predicted 761
7 SASI_Mm02_00330656 predicted 2574
8 SASI_Mm01_00088435 predicted 2049
9 SASI_Mm02_00330657 predicted 1269
10 SASI_Mm02_00330658 predicted 1126
11 SASI_Mm01_00088426 predicted 510
12 SASI_Mm01_00088427 predicted 379
13 SASI_Mm01_00088428 predicted 303
14 SASI_Mm01_00088431 predicted 249
15 SASI_Mm01_00088432 predicted 651
16 SASI_Mm01_00088433 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018289
VALIDATED
VPS53 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 53 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-1185s1c1
Sequence:CCGGGATCAACCAAAGAAGCCTAAACTCGAGTTTAGGCTTCTTTGGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-1961s1c1
Sequence:CCGGCACTCAGTTCTGCGTTAAATTCTCGAGAATTTAACGCAGAACTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-347s1c1
Sequence:CCGGGAAAGAAATCACCCGTGATATCTCGAGATATCACGGGTGATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018289.2-1248s1c1
Sequence:CCGGGAGCCTCATCTCTACGTGTATCTCGAGATACACGTAGAGATGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-1475s1c1
Sequence:CCGGCCAGAAGTACCTCCGAGAATACTCGAGTATTCTCGGAGGTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-275s21c1
Sequence:CCGGATGCTGTTGAGTATATCAATACTCGAGTATTGATATACTCAACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-311s21c1
Sequence:CCGGAGCAATCTCTGGCGAACATAGCTCGAGCTATGTTCGCCAGAGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018289.3-2396s21c1
Sequence:CCGGTAGTGCTCACACTCCAATAAGCTCGAGCTTATTGGAGTGTGAGCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018289.3-2219s21c1
Sequence:CCGGGATCTACTTGGCAGGAATAAACTCGAGTTTATTCCTGCCAAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-2144s21c1
Sequence:CCGGAGGTGAGATGGACGTAGTATCCTCGAGGATACTACGTCCATCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-778s21c1
Sequence:CCGGGATGCATGTCTGGTTGCTAATCTCGAGATTAGCAACCAGACATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-1846s21c1
Sequence:CCGGACCGTCATCTCCAGCAGTATTCTCGAGAATACTGCTGGAGATGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018289.3-2343s21c1
Sequence:CCGGAGTTCTGGGTGCAGGGTATAACTCGAGTTATACCCTGCACCCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018289
VALIDATED
VPS53 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 53 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-1185s1c1
Sequence:CCGGGATCAACCAAAGAAGCCTAAACTCGAGTTTAGGCTTCTTTGGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-1961s1c1
Sequence:CCGGCACTCAGTTCTGCGTTAAATTCTCGAGAATTTAACGCAGAACTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-347s1c1
Sequence:CCGGGAAAGAAATCACCCGTGATATCTCGAGATATCACGGGTGATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018289.2-1248s1c1
Sequence:CCGGGAGCCTCATCTCTACGTGTATCTCGAGATACACGTAGAGATGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-1475s1c1
Sequence:CCGGCCAGAAGTACCTCCGAGAATACTCGAGTATTCTCGGAGGTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-275s21c1
Sequence:CCGGATGCTGTTGAGTATATCAATACTCGAGTATTGATATACTCAACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-311s21c1
Sequence:CCGGAGCAATCTCTGGCGAACATAGCTCGAGCTATGTTCGCCAGAGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018289.3-2396s21c1
Sequence:CCGGTAGTGCTCACACTCCAATAAGCTCGAGCTTATTGGAGTGTGAGCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018289.3-2219s21c1
Sequence:CCGGGATCTACTTGGCAGGAATAAACTCGAGTTTATTCCTGCCAAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-2144s21c1
Sequence:CCGGAGGTGAGATGGACGTAGTATCCTCGAGGATACTACGTCCATCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-778s21c1
Sequence:CCGGGATGCATGTCTGGTTGCTAATCTCGAGATTAGCAACCAGACATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-1846s21c1
Sequence:CCGGACCGTCATCTCCAGCAGTATTCTCGAGAATACTGCTGGAGATGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018289.3-2343s21c1
Sequence:CCGGAGTTCTGGGTGCAGGGTATAACTCGAGTTATACCCTGCACCCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018289
VALIDATED
VPS53 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 53 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-1185s1c1
Sequence:CCGGGATCAACCAAAGAAGCCTAAACTCGAGTTTAGGCTTCTTTGGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-1961s1c1
Sequence:CCGGCACTCAGTTCTGCGTTAAATTCTCGAGAATTTAACGCAGAACTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-347s1c1
Sequence:CCGGGAAAGAAATCACCCGTGATATCTCGAGATATCACGGGTGATTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018289.2-1248s1c1
Sequence:CCGGGAGCCTCATCTCTACGTGTATCTCGAGATACACGTAGAGATGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018289.2-1475s1c1
Sequence:CCGGCCAGAAGTACCTCCGAGAATACTCGAGTATTCTCGGAGGTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-275s21c1
Sequence:CCGGATGCTGTTGAGTATATCAATACTCGAGTATTGATATACTCAACAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-311s21c1
Sequence:CCGGAGCAATCTCTGGCGAACATAGCTCGAGCTATGTTCGCCAGAGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018289.3-2396s21c1
Sequence:CCGGTAGTGCTCACACTCCAATAAGCTCGAGCTTATTGGAGTGTGAGCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018289.3-2219s21c1
Sequence:CCGGGATCTACTTGGCAGGAATAAACTCGAGTTTATTCCTGCCAAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-2144s21c1
Sequence:CCGGAGGTGAGATGGACGTAGTATCCTCGAGGATACTACGTCCATCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-778s21c1
Sequence:CCGGGATGCATGTCTGGTTGCTAATCTCGAGATTAGCAACCAGACATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018289.3-1846s21c1
Sequence:CCGGACCGTCATCTCCAGCAGTATTCTCGAGAATACTGCTGGAGATGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018289.3-2343s21c1
Sequence:CCGGAGTTCTGGGTGCAGGGTATAACTCGAGTTATACCCTGCACCCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026664
VALIDATED
VPS53 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 53 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.2-2296s1c1
Sequence:CCGGCCTGCCAGTTACACTAAGATTCTCGAGAATCTTAGTGTAACTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.2-1132s1c1
Sequence:CCGGGCCAGAGCTAAGGAAATTGAACTCGAGTTCAATTTCCTTAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.2-520s1c1
Sequence:CCGGCGAGATATTAAGCAGTTAGATCTCGAGATCTAACTGCTTAATATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.3-852s1c1
Sequence:CCGGGCGTGCCTGGTGGCTAATATTCTCGAGAATATTAGCCACCAGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.3-1868s1c1
Sequence:CCGGGAGCCTGACTGAACGAATTAACTCGAGTTAATTCGTTCAGTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026664.3-1131s21c1
Sequence:CCGGGCCAGAGCTAAGGAAATTGAACTCGAGTTCAATTTCCTTAGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026664.3-2642s21c1
Sequence:CCGGGCATGGCCAGAGTCCTGAACACTCGAGTGTTCAGGACTCTGGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026664.3-1868s21c1
Sequence:CCGGGAGCCTGACTGAACGAATTAACTCGAGTTAATTCGTTCAGTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026664.3-852s21c1
Sequence:CCGGGCGTGCCTGGTGGCTAATATTCTCGAGAATATTAGCCACCAGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026664
VALIDATED
VPS53 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 53 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.2-2296s1c1
Sequence:CCGGCCTGCCAGTTACACTAAGATTCTCGAGAATCTTAGTGTAACTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.2-1132s1c1
Sequence:CCGGGCCAGAGCTAAGGAAATTGAACTCGAGTTCAATTTCCTTAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.2-520s1c1
Sequence:CCGGCGAGATATTAAGCAGTTAGATCTCGAGATCTAACTGCTTAATATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.3-852s1c1
Sequence:CCGGGCGTGCCTGGTGGCTAATATTCTCGAGAATATTAGCCACCAGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.3-1868s1c1
Sequence:CCGGGAGCCTGACTGAACGAATTAACTCGAGTTAATTCGTTCAGTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026664.3-1131s21c1
Sequence:CCGGGCCAGAGCTAAGGAAATTGAACTCGAGTTCAATTTCCTTAGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026664.3-2642s21c1
Sequence:CCGGGCATGGCCAGAGTCCTGAACACTCGAGTGTTCAGGACTCTGGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026664.3-1868s21c1
Sequence:CCGGGAGCCTGACTGAACGAATTAACTCGAGTTAATTCGTTCAGTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026664.3-852s21c1
Sequence:CCGGGCGTGCCTGGTGGCTAATATTCTCGAGAATATTAGCCACCAGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026664
VALIDATED
VPS53 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 53 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.2-2296s1c1
Sequence:CCGGCCTGCCAGTTACACTAAGATTCTCGAGAATCTTAGTGTAACTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.2-1132s1c1
Sequence:CCGGGCCAGAGCTAAGGAAATTGAACTCGAGTTCAATTTCCTTAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.2-520s1c1
Sequence:CCGGCGAGATATTAAGCAGTTAGATCTCGAGATCTAACTGCTTAATATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.3-852s1c1
Sequence:CCGGGCGTGCCTGGTGGCTAATATTCTCGAGAATATTAGCCACCAGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_026664.3-1868s1c1
Sequence:CCGGGAGCCTGACTGAACGAATTAACTCGAGTTAATTCGTTCAGTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026664.3-1131s21c1
Sequence:CCGGGCCAGAGCTAAGGAAATTGAACTCGAGTTCAATTTCCTTAGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026664.3-2642s21c1
Sequence:CCGGGCATGGCCAGAGTCCTGAACACTCGAGTGTTCAGGACTCTGGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026664.3-1868s21c1
Sequence:CCGGGAGCCTGACTGAACGAATTAACTCGAGTTAATTCGTTCAGTCAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026664.3-852s21c1
Sequence:CCGGGCGTGCCTGGTGGCTAATATTCTCGAGAATATTAGCCACCAGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks