EMAIL THIS PAGE TO A FRIEND

VPS54

vacuolar protein sorting 54 homolog (S. cerevisiae)

Synonyms: HCC8 SLP-8p VPS54L WR hVps54L
Gene ID:
Human(51542) Summary: This gene encodes for a protein that in yeast forms part of a trimeric vacuolar-protein-sorting complex that is required for retrograde transport of proteins from prevacuoles to the late Golgi compartment. As in yeast, mammalian Vps54 proteins contain a coiled-coil region and dileucine motifs. Alternative splicing results in multiple transcript variants encoding different isoforms [provided by RefSeq, Jul 2008]
Mouse(245944) vacuolar protein sorting 54 (yeast)
Rat(286932) vacuolar protein sorting 54 homolog (S. cerevisiae)
cow(783762) vacuolar protein sorting 54 homolog (S. cerevisiae)
sheep(101115354) vacuolar protein sorting 54 homolog (S. cerevisiae)
Domestic Rabbit(100341155) vacuolar protein sorting 54 homolog (S. cerevisiae)
naked mole-rat(101719371) vacuolar protein sorting 54 homolog (S. cerevisiae)
domestic guinea pig(100728968) vacuolar protein sorting 54 homolog (S. cerevisiae)
Thale Cress(827690) protein VPS54
chicken(421280) vacuolar protein sorting 54 homolog (S. cerevisiae)
Zebrafish(562169) vacuolar protein sorting 54 homolog (S. cerevisiae)
Horse(100051472) vacuolar protein sorting 54 homolog (S. cerevisiae)
domestic cat(101082143) vacuolar protein sorting 54 homolog (S. cerevisiae)
dog(474616) vacuolar protein sorting 54 homolog (S. cerevisiae)
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005739 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005739 Rosetta Predictions human pricing
NM_016516 Rosetta Predictions human pricing
NM_173147 Rosetta Predictions rat pricing
NM_139061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211359 predicted 3013
2 SASI_Hs02_00305006 predicted 1823
3 SASI_Hs01_00211360 predicted 2567
4 SASI_Hs01_00211362 predicted 1710
5 SASI_Hs01_00211363 predicted 1120
6 SASI_Hs01_00211366 predicted 2005
7 SASI_Hs01_00211367 predicted 3132
8 SASI_Hs01_00211368 predicted 1023
9 SASI_Hs02_00305007 predicted 1200
10 SASI_Hs02_00305008 predicted 1106
11 SASI_Hs01_00211361 predicted 772
12 SASI_Hs01_00211364 predicted 1002
13 SASI_Hs01_00211365 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033722 predicted 3058
2 SASI_Hs02_00349606 predicted 1856
3 SASI_Hs01_00033723 predicted 2604
4 SASI_Hs01_00033725 predicted 1742
5 SASI_Hs01_00033726 predicted 1151
6 SASI_Hs01_00033729 predicted 2038
7 SASI_Hs01_00033730 predicted 3174
8 SASI_Hs01_00033731 predicted 1059
9 SASI_Hs02_00349607 predicted 1230
10 SASI_Hs02_00349608 predicted 1144
11 SASI_Hs01_00033724 predicted 804
12 SASI_Hs01_00033727 predicted 1028
13 SASI_Hs01_00033728 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269331 predicted 1882
2 SASI_Rn02_00269332 predicted 1723
3 SASI_Rn01_00051941 predicted 2577
4 SASI_Rn01_00051944 predicted 1890
5 SASI_Rn02_00269333 predicted 823
6 SASI_Rn01_00051946 predicted 2193
7 SASI_Rn01_00051947 predicted 617
8 SASI_Rn01_00051948 predicted 753
9 SASI_Rn02_00269334 predicted 494
10 SASI_Rn01_00051949 predicted 2336
11 SASI_Rn01_00051942 predicted 2121
12 SASI_Rn01_00051943 predicted 2738
13 SASI_Rn01_00051945 predicted 2540
14 SASI_Rn01_00051950 predicted 2872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119733 predicted 2866
2 SASI_Mm01_00119734 predicted 2011
3 SASI_Mm01_00119735 predicted 1905
4 SASI_Mm01_00119736 predicted 974
5 SASI_Mm01_00119737 predicted 1851
6 SASI_Mm02_00339867 predicted 1831
7 SASI_Mm01_00119738 predicted 883
8 SASI_Mm01_00119739 predicted 2848
9 SASI_Mm01_00119740 predicted 1900
10 SASI_Mm01_00119741 predicted 1101
11 SASI_Mm01_00119742 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005739
VALIDATED
VPS54 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 54 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005739.1-2437s21c1
Sequence:GTACCGGTACTCGTCTGTCAGATTTATTCTCGAGAATAAATCTGACAGACGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005739.1-2506s21c1
Sequence:GTACCGGACTGCAAGTTGTTGGACTAAACTCGAGTTTAGTCCAACAACTTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-2714s21c1
Sequence:CCGGGCGATAATGGATAGCTTATTTCTCGAGAAATAAGCTATCCATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-3440s21c1
Sequence:CCGGTATGGTGTCCCACCTTATTTACTCGAGTAAATAAGGTGGGACACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-2413s21c1
Sequence:CCGGCCCATCTGTTACTACTGACATCTCGAGATGTCAGTAGTAACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-1257s21c1
Sequence:CCGGTAGAAGAGGAAAGACTAATATCTCGAGATATTAGTCTTTCCTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-1956s21c1
Sequence:CCGGGCCATGATCGAGCTGTCAAATCTCGAGATTTGACAGCTCGATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005739.1-2115s21c1
Sequence:GTACCGGCACTTCAGAGCCAAGCTATTACTCGAGTAATAGCTTGGCTCTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005739.1-3632s1c1
Sequence:CCGGGCAGGCTTTGTGTGTTGCATACTCGAGTATGCAACACACAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005739.1-3009s1c1
Sequence:CCGGGCCTTAAAGATTTGGACCTAACTCGAGTTAGGTCCAAATCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005739.1-2413s1c1
Sequence:CCGGCCCATCTGTTACTACTGACATCTCGAGATGTCAGTAGTAACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005739.1-1956s1c1
Sequence:CCGGGCCATGATCGAGCTGTCAAATCTCGAGATTTGACAGCTCGATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005739.1-2402s1c1
Sequence:CCGGGTGGATAACATCCCATCTGTTCTCGAGAACAGATGGGATGTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005739
VALIDATED
VPS54 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 54 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005739.1-2437s21c1
Sequence:GTACCGGTACTCGTCTGTCAGATTTATTCTCGAGAATAAATCTGACAGACGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005739.1-2506s21c1
Sequence:GTACCGGACTGCAAGTTGTTGGACTAAACTCGAGTTTAGTCCAACAACTTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-2714s21c1
Sequence:CCGGGCGATAATGGATAGCTTATTTCTCGAGAAATAAGCTATCCATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-3440s21c1
Sequence:CCGGTATGGTGTCCCACCTTATTTACTCGAGTAAATAAGGTGGGACACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-2413s21c1
Sequence:CCGGCCCATCTGTTACTACTGACATCTCGAGATGTCAGTAGTAACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-1257s21c1
Sequence:CCGGTAGAAGAGGAAAGACTAATATCTCGAGATATTAGTCTTTCCTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-1956s21c1
Sequence:CCGGGCCATGATCGAGCTGTCAAATCTCGAGATTTGACAGCTCGATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005739.1-2115s21c1
Sequence:GTACCGGCACTTCAGAGCCAAGCTATTACTCGAGTAATAGCTTGGCTCTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005739.1-3632s1c1
Sequence:CCGGGCAGGCTTTGTGTGTTGCATACTCGAGTATGCAACACACAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005739.1-3009s1c1
Sequence:CCGGGCCTTAAAGATTTGGACCTAACTCGAGTTAGGTCCAAATCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005739.1-2413s1c1
Sequence:CCGGCCCATCTGTTACTACTGACATCTCGAGATGTCAGTAGTAACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005739.1-1956s1c1
Sequence:CCGGGCCATGATCGAGCTGTCAAATCTCGAGATTTGACAGCTCGATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005739.1-2402s1c1
Sequence:CCGGGTGGATAACATCCCATCTGTTCTCGAGAACAGATGGGATGTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005739
VALIDATED
VPS54 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 54 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005739.1-2437s21c1
Sequence:GTACCGGTACTCGTCTGTCAGATTTATTCTCGAGAATAAATCTGACAGACGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005739.1-2506s21c1
Sequence:GTACCGGACTGCAAGTTGTTGGACTAAACTCGAGTTTAGTCCAACAACTTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-2714s21c1
Sequence:CCGGGCGATAATGGATAGCTTATTTCTCGAGAAATAAGCTATCCATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-3440s21c1
Sequence:CCGGTATGGTGTCCCACCTTATTTACTCGAGTAAATAAGGTGGGACACCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-2413s21c1
Sequence:CCGGCCCATCTGTTACTACTGACATCTCGAGATGTCAGTAGTAACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-1257s21c1
Sequence:CCGGTAGAAGAGGAAAGACTAATATCTCGAGATATTAGTCTTTCCTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001005739.1-1956s21c1
Sequence:CCGGGCCATGATCGAGCTGTCAAATCTCGAGATTTGACAGCTCGATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005739.1-2115s21c1
Sequence:GTACCGGCACTTCAGAGCCAAGCTATTACTCGAGTAATAGCTTGGCTCTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005739.1-3632s1c1
Sequence:CCGGGCAGGCTTTGTGTGTTGCATACTCGAGTATGCAACACACAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005739.1-3009s1c1
Sequence:CCGGGCCTTAAAGATTTGGACCTAACTCGAGTTAGGTCCAAATCTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005739.1-2413s1c1
Sequence:CCGGCCCATCTGTTACTACTGACATCTCGAGATGTCAGTAGTAACAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005739.1-1956s1c1
Sequence:CCGGGCCATGATCGAGCTGTCAAATCTCGAGATTTGACAGCTCGATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005739.1-2402s1c1
Sequence:CCGGGTGGATAACATCCCATCTGTTCTCGAGAACAGATGGGATGTTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139061
VPS54 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 54 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-1206s21c1
Sequence:GTACCGGATGACCTCTCAACACGAATTGCTCGAGCAATTCGTGTTGAGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-2039s21c1
Sequence:GTACCGGACACGAGGGCTGGTTCATAAGCTCGAGCTTATGAACCAGCCCTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-3077s21c1
Sequence:GTACCGGAGCTAAGCTTGTAGCGATAATCTCGAGATTATCGCTACAAGCTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-2334s21c1
Sequence:GTACCGGCATGATCGAGCTGTCAAATTTCTCGAGAAATTTGACAGCTCGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-2236s1c1
Sequence:CCGGGCGGATGGAAAGATTGCTTTACTCGAGTAAAGCAATCTTTCCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-337s1c1
Sequence:CCGGGCATTAAATGATCCTACACTACTCGAGTAGTGTAGGATCATTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-2698s1c1
Sequence:CCGGGCGATAATGGATAGCCTATTTCTCGAGAAATAGGCTATCCATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-1445s1c1
Sequence:CCGGCCCAGTGGATTGATCTGTTAACTCGAGTTAACAGATCAATCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139061
VPS54 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 54 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-1206s21c1
Sequence:GTACCGGATGACCTCTCAACACGAATTGCTCGAGCAATTCGTGTTGAGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-2039s21c1
Sequence:GTACCGGACACGAGGGCTGGTTCATAAGCTCGAGCTTATGAACCAGCCCTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-3077s21c1
Sequence:GTACCGGAGCTAAGCTTGTAGCGATAATCTCGAGATTATCGCTACAAGCTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-2334s21c1
Sequence:GTACCGGCATGATCGAGCTGTCAAATTTCTCGAGAAATTTGACAGCTCGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-2236s1c1
Sequence:CCGGGCGGATGGAAAGATTGCTTTACTCGAGTAAAGCAATCTTTCCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-337s1c1
Sequence:CCGGGCATTAAATGATCCTACACTACTCGAGTAGTGTAGGATCATTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-2698s1c1
Sequence:CCGGGCGATAATGGATAGCCTATTTCTCGAGAAATAGGCTATCCATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-1445s1c1
Sequence:CCGGCCCAGTGGATTGATCTGTTAACTCGAGTTAACAGATCAATCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139061
VPS54 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 54 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-1206s21c1
Sequence:GTACCGGATGACCTCTCAACACGAATTGCTCGAGCAATTCGTGTTGAGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-2039s21c1
Sequence:GTACCGGACACGAGGGCTGGTTCATAAGCTCGAGCTTATGAACCAGCCCTCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-3077s21c1
Sequence:GTACCGGAGCTAAGCTTGTAGCGATAATCTCGAGATTATCGCTACAAGCTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139061.4-2334s21c1
Sequence:GTACCGGCATGATCGAGCTGTCAAATTTCTCGAGAAATTTGACAGCTCGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-2236s1c1
Sequence:CCGGGCGGATGGAAAGATTGCTTTACTCGAGTAAAGCAATCTTTCCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-337s1c1
Sequence:CCGGGCATTAAATGATCCTACACTACTCGAGTAGTGTAGGATCATTTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-2698s1c1
Sequence:CCGGGCGATAATGGATAGCCTATTTCTCGAGAAATAGGCTATCCATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139061.2-1445s1c1
Sequence:CCGGCCCAGTGGATTGATCTGTTAACTCGAGTTAACAGATCAATCCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks