EMAIL THIS PAGE TO A FRIEND

VPS72

vacuolar protein sorting 72 homolog (S. cerevisiae)

Synonyms: CFL1 Swc2 TCFL1 YL-1 YL1
UniProtKB ID: Q15906, A6NLK9, A6PW55, Q53GJ2, Q5U0R4
Gene ID:
Human(6944) Summary: The protein encoded by this gene is a shared subunit of two multi-component complexes, the histone acetyltransferase complex TRRAP/TIP60 as well as the chromatin remodeling SRCAP-containing complex. The TRRAP/TIP60 complex acetylates nucleosomal histones important for transcriptional regulation, double strand DNA break repair and apoptosis. The SRCAP-containing complex catalyzes the exchange of histone H2A with the histone variant Htz1 (H2AFZ) into nucleosomes. This protein may be responsible for binding H2AFZ, which has a role in chromosome segregation. This protein may also have a role in regulating long-term hematopoietic stem cell activity. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Mouse(21427) vacuolar protein sorting 72 (yeast)
Rat(310661) vacuolar protein sorting 72 homolog (S. cerevisiae)
Zebrafish(100001285) vacuolar protein sorting 72 homolog (S. cerevisiae)
chicken(425660) vacuolar protein sorting 72 homolog (S. cerevisiae)
dog(475843) vacuolar protein sorting 72 homolog (S. cerevisiae)
Horse(100147071) vacuolar protein sorting 72 homolog (S. cerevisiae)
domestic cat(101097749) vacuolar protein sorting 72 homolog (S. cerevisiae)
domestic guinea pig(100713883) vacuolar protein sorting 72 homolog (S. cerevisiae)
naked mole-rat(101704477) vacuolar protein sorting 72 homolog (S. cerevisiae)
Domestic Rabbit(100328667) vacuolar protein sorting 72 homolog (S. cerevisiae)
cow(534883) vacuolar protein sorting 72 homolog (S. cerevisiae)
sheep(101113547) vacuolar protein sorting 72 homolog (S. cerevisiae)
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34072 Anti-TCFL1 antibody produced in rabbit affinity isolated antibody bovine, mouse, zebrafish, rabbit, human, rat, guinea pig, rabbit, horse, canine
western blot pricing
SAB1406514 Anti-VPS72 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4502933 Anti-VPS72 antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB2106298 Anti-VPS72 antibody produced in rabbit affinity isolated antibody horse, human, mouse, guinea pig, rabbit
ELISA, western blot pricing
SAB1411334 Anti-VPS72 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA065709 Anti-VPS72 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2104744 Anti-VPS72, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, rat, mouse, human, horse
western blot pricing
WH0006944M1 Monoclonal Anti-VPS72 antibody produced in mouse clone 2G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0276 Rabbit anti-YL1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, mouse, rat, horse, marmoset, dog, rabbit, rhesus monkey, chimpanzee, primate, human
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005997 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009336 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009336 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009336 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005997 Rosetta Predictions human pricing
NM_001107695 Rosetta Predictions rat pricing
XM_227428 Rosetta Predictions rat pricing
NM_009336 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022162 predicted 287
2 SASI_Hs02_00340701 predicted 916
3 SASI_Hs01_00022165 predicted 298
4 SASI_Hs01_00022167 predicted 898
5 SASI_Hs01_00022168 predicted 935
6 SASI_Hs02_00340702 predicted 394
7 SASI_Hs01_00022169 predicted 275
8 SASI_Hs02_00340703 predicted 422
9 SASI_Hs01_00022171 predicted 368
10 SASI_Hs02_00340704 predicted 669
11 SASI_Hs01_00022163 predicted 990
12 SASI_Hs01_00022164 predicted 1008
13 SASI_Hs01_00022166 predicted 526
14 SASI_Hs01_00022170 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231365 predicted 225
2 SASI_Rn02_00231366 predicted 479
3 SASI_Rn02_00231367 predicted 992
4 SASI_Rn02_00231368 predicted 773
5 SASI_Rn02_00231369 predicted 863
6 SASI_Rn02_00231370 predicted 456
7 SASI_Rn02_00231371 predicted 295
8 SASI_Rn02_00231372 predicted 590
9 SASI_Rn02_00231373 predicted 308
10 SASI_Rn02_00231374 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177567 predicted 225
2 SASI_Rn01_00177568 predicted 478
3 SASI_Rn01_00177569 predicted 775
4 SASI_Rn01_00177570 predicted 860
5 SASI_Rn01_00177571 predicted 465
6 SASI_Rn01_00177572 predicted 674
7 SASI_Rn01_00177573 predicted 594
8 SASI_Rn01_00177574 predicted 586
9 SASI_Rn01_00177575 predicted 311
10 SASI_Rn01_00177576 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315895 predicted 430
2 SASI_Mm02_00315896 predicted 695
3 SASI_Mm02_00315897 predicted 1000
4 SASI_Mm02_00315898 predicted 289
5 SASI_Mm02_00315899 predicted 583
6 SASI_Mm02_00315900 predicted 297
7 SASI_Mm02_00315901 predicted 447
8 SASI_Mm02_00315902 predicted 1002
9 SASI_Mm02_00315903 predicted 461
10 SASI_Mm02_00315904 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005997
VALIDATED
VPS72 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 72 homolog (S. cerevisiae)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005997.1-1140s1c1
Sequence:CCGGGAGATGTCTAGTCCTCAGAAACTCGAGTTTCTGAGGACTAGACATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005997.1-640s1c1
Sequence:CCGGGCAGGTTCATAAGAAGCGGAACTCGAGTTCCGCTTCTTATGAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005997.1-1139s1c1
Sequence:CCGGAGAGATGTCTAGTCCTCAGAACTCGAGTTCTGAGGACTAGACATCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005997.1-1004s1c1
Sequence:CCGGGAGGCTTACAAGAAGTACATTCTCGAGAATGTACTTCTTGTAAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-1148s21c1
Sequence:GTACCGGTAGTCCTCAGAAACTTCTTTCCTCGAGGAAAGAAGTTTCTGAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-125s21c1
Sequence:CCGGGAGTTCTACCAGACGACTTATCTCGAGATAAGTCGTCTGGTAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005997.1-1004s21c1
Sequence:CCGGGAGGCTTACAAGAAGTACATTCTCGAGAATGTACTTCTTGTAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-312s21c1
Sequence:GTACCGGAGGAACCTCTCAAGAGCTTAACTCGAGTTAAGCTCTTGAGAGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005997.1-573s21c1
Sequence:GTACCGGAGATCACAGAAGAGCTTAATTCTCGAGAATTAAGCTCTTCTGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005997.1-670s21c1
Sequence:GTACCGGGCCCATAATCACCTATCATTCCTCGAGGAATGATAGGTGATTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-593s21c1
Sequence:GTACCGGTTACGGTCACTGGAGACATATCTCGAGATATGTCTCCAGTGACCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-164s21c1
Sequence:GTACCGGTCCGGAGATGATGAGTATCAACTCGAGTTGATACTCATCATCTCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-207s21c1
Sequence:GTACCGGACGAAGTGGACTCTGACTTTGCTCGAGCAAAGTCAGAGTCCACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-384s21c1
Sequence:GTACCGGAGAAGGCACTACTGCCATTAGCTCGAGCTAATGGCAGTAGTGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005997.1-1140s21c1
Sequence:CCGGGAGATGTCTAGTCCTCAGAAACTCGAGTTTCTGAGGACTAGACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-292s21c1
Sequence:CCGGAGTAGTCACCAAGGCCTATAACTCGAGTTATAGGCCTTGGTGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005997
VALIDATED
VPS72 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 72 homolog (S. cerevisiae)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005997.1-1140s1c1
Sequence:CCGGGAGATGTCTAGTCCTCAGAAACTCGAGTTTCTGAGGACTAGACATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005997.1-640s1c1
Sequence:CCGGGCAGGTTCATAAGAAGCGGAACTCGAGTTCCGCTTCTTATGAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005997.1-1139s1c1
Sequence:CCGGAGAGATGTCTAGTCCTCAGAACTCGAGTTCTGAGGACTAGACATCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005997.1-1004s1c1
Sequence:CCGGGAGGCTTACAAGAAGTACATTCTCGAGAATGTACTTCTTGTAAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-1148s21c1
Sequence:GTACCGGTAGTCCTCAGAAACTTCTTTCCTCGAGGAAAGAAGTTTCTGAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-125s21c1
Sequence:CCGGGAGTTCTACCAGACGACTTATCTCGAGATAAGTCGTCTGGTAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005997.1-1004s21c1
Sequence:CCGGGAGGCTTACAAGAAGTACATTCTCGAGAATGTACTTCTTGTAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-312s21c1
Sequence:GTACCGGAGGAACCTCTCAAGAGCTTAACTCGAGTTAAGCTCTTGAGAGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005997.1-573s21c1
Sequence:GTACCGGAGATCACAGAAGAGCTTAATTCTCGAGAATTAAGCTCTTCTGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005997.1-670s21c1
Sequence:GTACCGGGCCCATAATCACCTATCATTCCTCGAGGAATGATAGGTGATTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-593s21c1
Sequence:GTACCGGTTACGGTCACTGGAGACATATCTCGAGATATGTCTCCAGTGACCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-164s21c1
Sequence:GTACCGGTCCGGAGATGATGAGTATCAACTCGAGTTGATACTCATCATCTCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-207s21c1
Sequence:GTACCGGACGAAGTGGACTCTGACTTTGCTCGAGCAAAGTCAGAGTCCACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-384s21c1
Sequence:GTACCGGAGAAGGCACTACTGCCATTAGCTCGAGCTAATGGCAGTAGTGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005997.1-1140s21c1
Sequence:CCGGGAGATGTCTAGTCCTCAGAAACTCGAGTTTCTGAGGACTAGACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-292s21c1
Sequence:CCGGAGTAGTCACCAAGGCCTATAACTCGAGTTATAGGCCTTGGTGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005997
VALIDATED
VPS72 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 72 homolog (S. cerevisiae)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005997.1-1140s1c1
Sequence:CCGGGAGATGTCTAGTCCTCAGAAACTCGAGTTTCTGAGGACTAGACATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005997.1-640s1c1
Sequence:CCGGGCAGGTTCATAAGAAGCGGAACTCGAGTTCCGCTTCTTATGAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005997.1-1139s1c1
Sequence:CCGGAGAGATGTCTAGTCCTCAGAACTCGAGTTCTGAGGACTAGACATCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005997.1-1004s1c1
Sequence:CCGGGAGGCTTACAAGAAGTACATTCTCGAGAATGTACTTCTTGTAAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-1148s21c1
Sequence:GTACCGGTAGTCCTCAGAAACTTCTTTCCTCGAGGAAAGAAGTTTCTGAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-125s21c1
Sequence:CCGGGAGTTCTACCAGACGACTTATCTCGAGATAAGTCGTCTGGTAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005997.1-1004s21c1
Sequence:CCGGGAGGCTTACAAGAAGTACATTCTCGAGAATGTACTTCTTGTAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-312s21c1
Sequence:GTACCGGAGGAACCTCTCAAGAGCTTAACTCGAGTTAAGCTCTTGAGAGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005997.1-573s21c1
Sequence:GTACCGGAGATCACAGAAGAGCTTAATTCTCGAGAATTAAGCTCTTCTGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005997.1-670s21c1
Sequence:GTACCGGGCCCATAATCACCTATCATTCCTCGAGGAATGATAGGTGATTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-593s21c1
Sequence:GTACCGGTTACGGTCACTGGAGACATATCTCGAGATATGTCTCCAGTGACCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-164s21c1
Sequence:GTACCGGTCCGGAGATGATGAGTATCAACTCGAGTTGATACTCATCATCTCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-207s21c1
Sequence:GTACCGGACGAAGTGGACTCTGACTTTGCTCGAGCAAAGTCAGAGTCCACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-384s21c1
Sequence:GTACCGGAGAAGGCACTACTGCCATTAGCTCGAGCTAATGGCAGTAGTGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005997.1-1140s21c1
Sequence:CCGGGAGATGTCTAGTCCTCAGAAACTCGAGTTTCTGAGGACTAGACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005997.1-292s21c1
Sequence:CCGGAGTAGTCACCAAGGCCTATAACTCGAGTTATAGGCCTTGGTGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009336
VALIDATED
VPS72 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 72 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009336.1-416s1c1
Sequence:CCGGGCAAGTCTATGCGTCAGTCTACTCGAGTAGACTGACGCATAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-1110s1c1
Sequence:CCGGGCGTCAGAAGATTGTCATCAACTCGAGTTGATGACAATCTTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-288s1c1
Sequence:CCGGAGCCTATAAGGAGCCTCTAAACTCGAGTTTAGAGGCTCCTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-1112s1c1
Sequence:CCGGGTCAGAAGATTGTCATCAAATCTCGAGATTTGATGACAATCTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-580s1c1
Sequence:CCGGCGTTCACTCGAGACCTATGAACTCGAGTTCATAGGTCTCGAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-609s21c1
Sequence:CCGGCGTTCACTCGAGACCTATGAACTCGAGTTCATAGGTCTCGAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-1139s21c1
Sequence:CCGGGCGTCAGAAGATTGTCATCAACTCGAGTTGATGACAATCTTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009336.2-671s21c1
Sequence:CCGGGAAGTGCCCTGGGCCAATAATCTCGAGATTATTGGCCCAGGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-1249s21c1
Sequence:CCGGCAGTTCCTCCCTAGTTCATTTCTCGAGAAATGAACTAGGGAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-317s21c1
Sequence:CCGGAGCCTATAAGGAGCCTCTAAACTCGAGTTTAGAGGCTCCTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009336
VALIDATED
VPS72 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 72 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009336.1-416s1c1
Sequence:CCGGGCAAGTCTATGCGTCAGTCTACTCGAGTAGACTGACGCATAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-1110s1c1
Sequence:CCGGGCGTCAGAAGATTGTCATCAACTCGAGTTGATGACAATCTTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-288s1c1
Sequence:CCGGAGCCTATAAGGAGCCTCTAAACTCGAGTTTAGAGGCTCCTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-1112s1c1
Sequence:CCGGGTCAGAAGATTGTCATCAAATCTCGAGATTTGATGACAATCTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-580s1c1
Sequence:CCGGCGTTCACTCGAGACCTATGAACTCGAGTTCATAGGTCTCGAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-609s21c1
Sequence:CCGGCGTTCACTCGAGACCTATGAACTCGAGTTCATAGGTCTCGAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-1139s21c1
Sequence:CCGGGCGTCAGAAGATTGTCATCAACTCGAGTTGATGACAATCTTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009336.2-671s21c1
Sequence:CCGGGAAGTGCCCTGGGCCAATAATCTCGAGATTATTGGCCCAGGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-1249s21c1
Sequence:CCGGCAGTTCCTCCCTAGTTCATTTCTCGAGAAATGAACTAGGGAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-317s21c1
Sequence:CCGGAGCCTATAAGGAGCCTCTAAACTCGAGTTTAGAGGCTCCTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009336
VALIDATED
VPS72 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 72 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009336.1-416s1c1
Sequence:CCGGGCAAGTCTATGCGTCAGTCTACTCGAGTAGACTGACGCATAGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-1110s1c1
Sequence:CCGGGCGTCAGAAGATTGTCATCAACTCGAGTTGATGACAATCTTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-288s1c1
Sequence:CCGGAGCCTATAAGGAGCCTCTAAACTCGAGTTTAGAGGCTCCTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-1112s1c1
Sequence:CCGGGTCAGAAGATTGTCATCAAATCTCGAGATTTGATGACAATCTTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009336.1-580s1c1
Sequence:CCGGCGTTCACTCGAGACCTATGAACTCGAGTTCATAGGTCTCGAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-609s21c1
Sequence:CCGGCGTTCACTCGAGACCTATGAACTCGAGTTCATAGGTCTCGAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-1139s21c1
Sequence:CCGGGCGTCAGAAGATTGTCATCAACTCGAGTTGATGACAATCTTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009336.2-671s21c1
Sequence:CCGGGAAGTGCCCTGGGCCAATAATCTCGAGATTATTGGCCCAGGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-1249s21c1
Sequence:CCGGCAGTTCCTCCCTAGTTCATTTCTCGAGAAATGAACTAGGGAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009336.2-317s21c1
Sequence:CCGGAGCCTATAAGGAGCCTCTAAACTCGAGTTTAGAGGCTCCTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks