EMAIL THIS PAGE TO A FRIEND

VPS8

vacuolar protein sorting 8 homolog (S. cerevisiae)

Synonyms: KIAA0804
Gene ID:
Mouse(209018) vacuolar protein sorting 8 homolog (S. cerevisiae)
Rat(287990) vacuolar protein sorting 8 homolog (S. cerevisiae)
cow(615672) vacuolar protein sorting 8 homolog (S. cerevisiae)
sheep(101118404) vacuolar protein sorting 8 homolog (S. cerevisiae)
Domestic Rabbit(100346898) vacuolar protein sorting 8 homolog (S. cerevisiae)
naked mole-rat(101715959) vacuolar protein sorting 8 homolog (S. cerevisiae)
domestic guinea pig(100731875) vacuolar protein sorting 8 homolog (S. cerevisiae)
Zebrafish(791134) vacuolar protein sorting 8 homolog (S. cerevisiae)
chicken(429138) vacuolar protein sorting 8 homolog (S. cerevisiae)
dog(478658) vacuolar protein sorting 8 homolog (S. cerevisiae)
Horse(100059198) vacuolar protein sorting 8 homolog (S. cerevisiae)
domestic cat(101093706) vacuolar protein sorting 8 homolog (S. cerevisiae)
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015303 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009921 Rosetta Predictions human pricing
NM_015303 Rosetta Predictions human pricing
XM_001058757 Rosetta Predictions rat pricing
XM_221315 Rosetta Predictions rat pricing
NM_001081366 Rosetta Predictions mouse pricing
XM_484535 Rosetta Predictions mouse pricing
XM_893102 Rosetta Predictions mouse pricing
XM_900571 Rosetta Predictions mouse pricing
XM_900577 Rosetta Predictions mouse pricing
XM_900580 Rosetta Predictions mouse pricing
XM_900582 Rosetta Predictions mouse pricing
XM_900585 Rosetta Predictions mouse pricing
XM_900588 Rosetta Predictions mouse pricing
XM_900595 Rosetta Predictions mouse pricing
XM_900598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178655 predicted 1792
2 SASI_Hs01_00178656 predicted 4355
3 SASI_Hs01_00178658 predicted 3117
4 SASI_Hs02_00305715 predicted 319
5 SASI_Hs01_00178659 predicted 4422
6 SASI_Hs02_00305716 predicted 2334
7 SASI_Hs02_00305717 predicted 1436
8 SASI_Hs01_00178662 predicted 1417
9 SASI_Hs02_00305718 predicted 2131
10 SASI_Hs01_00178664 predicted 1823
11 SASI_Hs01_00178657 predicted 3211
12 SASI_Hs01_00178660 predicted 1466
13 SASI_Hs01_00178661 predicted 3754
14 SASI_Hs01_00178663 predicted 2628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142731 predicted 1785
2 SASI_Hs01_00142732 predicted 4350
3 SASI_Hs01_00142734 predicted 3113
4 SASI_Hs02_00347519 predicted 320
5 SASI_Hs01_00142735 predicted 4416
6 SASI_Hs02_00347520 predicted 2321
7 SASI_Hs02_00347521 predicted 1426
8 SASI_Hs01_00142738 predicted 1404
9 SASI_Hs02_00347522 predicted 2124
10 SASI_Hs01_00142740 predicted 1818
11 SASI_Hs01_00142733 predicted 3199
12 SASI_Hs01_00142736 predicted 1458
13 SASI_Hs01_00142737 predicted 3748
14 SASI_Hs01_00142739 predicted 2621
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290784 predicted 654
2 SASI_Rn02_00290785 predicted 2066
3 SASI_Rn02_00290786 predicted 2795
4 SASI_Rn02_00290787 predicted 4013
5 SASI_Rn02_00290788 predicted 3810
6 SASI_Rn02_00290789 predicted 1855
7 SASI_Rn02_00290790 predicted 348
8 SASI_Rn02_00290791 predicted 2708
9 SASI_Rn02_00290792 predicted 1079
10 SASI_Rn02_00290793 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380007 predicted 655
2 SASI_Rn02_00380008 predicted 972
3 SASI_Rn02_00380009 predicted 2793
4 SASI_Rn02_00380010 predicted 4014
5 SASI_Rn02_00380011 predicted 3666
6 SASI_Rn02_00380012 predicted 3808
7 SASI_Rn02_00380013 predicted 900
8 SASI_Rn02_00380014 predicted 351
9 SASI_Rn02_00380015 predicted 3168
10 SASI_Rn02_00380016 predicted 2710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297711 predicted 4345
2 SASI_Mm02_00297712 predicted 3125
3 SASI_Mm02_00297713 predicted 2776
4 SASI_Mm02_00297714 predicted 2303
5 SASI_Mm02_00297715 predicted 2363
6 SASI_Mm02_00297716 predicted 2673
7 SASI_Mm02_00297717 predicted 1687
8 SASI_Mm02_00297718 predicted 2650
9 SASI_Mm02_00297719 predicted 3626
10 SASI_Mm02_00297720 predicted 2740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259728 predicted 3124
2 SASI_Mm01_00259729 predicted 2782
3 SASI_Mm01_00259730 predicted 3993
4 SASI_Mm01_00259731 predicted 2309
5 SASI_Mm01_00259732 predicted 2354
6 SASI_Mm01_00259733 predicted 2681
7 SASI_Mm01_00259734 predicted 3683
8 SASI_Mm01_00259735 predicted 2644
9 SASI_Mm01_00259736 predicted 3626
10 SASI_Mm01_00259737 predicted 2743
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213937 predicted 2678
2 SASI_Mm01_00213938 predicted 3806
3 SASI_Mm01_00213939 predicted 2209
4 SASI_Mm01_00213940 predicted 2255
5 SASI_Mm01_00213941 predicted 2575
6 SASI_Mm01_00213942 predicted 3534
7 SASI_Mm01_00213943 predicted 3491
8 SASI_Mm01_00213944 predicted 2549
9 SASI_Mm01_00213945 predicted 3717
10 SASI_Mm01_00213946 predicted 3437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232127 predicted 3124
2 SASI_Mm01_00232128 predicted 2777
3 SASI_Mm01_00232129 predicted 3039
4 SASI_Mm01_00232130 predicted 2307
5 SASI_Mm01_00232131 predicted 2363
6 SASI_Mm01_00232132 predicted 2672
7 SASI_Mm01_00232133 predicted 3679
8 SASI_Mm01_00232134 predicted 2640
9 SASI_Mm01_00232135 predicted 3902
10 SASI_Mm01_00232136 predicted 3626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231692 predicted 3127
2 SASI_Mm01_00231693 predicted 2784
3 SASI_Mm01_00231694 predicted 3988
4 SASI_Mm01_00231695 predicted 2301
5 SASI_Mm01_00231696 predicted 2360
6 SASI_Mm01_00231697 predicted 2678
7 SASI_Mm01_00231698 predicted 3676
8 SASI_Mm01_00231699 predicted 2642
9 SASI_Mm01_00231700 predicted 3621
10 SASI_Mm01_00231701 predicted 2745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264831 predicted 956
2 SASI_Mm01_00264832 predicted 912
3 SASI_Mm01_00264833 predicted 924
4 SASI_Mm01_00264834 predicted 828
5 SASI_Mm01_00264835 predicted 1017
6 SASI_Mm01_00264836 predicted 1028
7 SASI_Mm01_00264837 predicted 1003
8 SASI_Mm01_00264838 predicted 763
9 SASI_Mm01_00264839 predicted 806
10 SASI_Mm01_00264840 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263844 predicted 1046
2 SASI_Mm01_00263845 predicted 1009
3 SASI_Mm01_00263846 predicted 1006
4 SASI_Mm01_00263847 predicted 737
5 SASI_Mm01_00263848 predicted 690
6 SASI_Mm01_00263849 predicted 920
7 SASI_Mm01_00263850 predicted 634
8 SASI_Mm01_00263851 predicted 1106
9 SASI_Mm01_00263852 predicted 1112
10 SASI_Mm01_00263853 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237948 predicted 297
2 SASI_Mm01_00237949 predicted 896
3 SASI_Mm01_00237950 predicted 1156
4 SASI_Mm01_00237951 predicted 711
5 SASI_Mm01_00237952 predicted 1215
6 SASI_Mm01_00237953 predicted 887
7 SASI_Mm01_00237954 predicted 849
8 SASI_Mm01_00237955 predicted 1078
9 SASI_Mm01_00237956 predicted 788
10 SASI_Mm01_00237957 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215077 predicted 1166
2 SASI_Mm01_00215078 predicted 824
3 SASI_Mm01_00215079 predicted 2024
4 SASI_Mm01_00215080 predicted 1078
5 SASI_Mm01_00215081 predicted 2091
6 SASI_Mm01_00215082 predicted 716
7 SASI_Mm01_00215083 predicted 1720
8 SASI_Mm01_00215084 predicted 1942
9 SASI_Mm01_00215085 predicted 1664
10 SASI_Mm01_00215086 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250132 predicted 3001
2 SASI_Mm01_00250133 predicted 2654
3 SASI_Mm01_00250134 predicted 3866
4 SASI_Mm01_00250135 predicted 2180
5 SASI_Mm01_00250136 predicted 2227
6 SASI_Mm01_00250137 predicted 2544
7 SASI_Mm01_00250138 predicted 3552
8 SASI_Mm01_00250139 predicted 2521
9 SASI_Mm01_00250140 predicted 3493
10 SASI_Mm01_00250141 predicted 2620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275445 predicted 3134
2 SASI_Mm01_00275446 predicted 2789
3 SASI_Mm01_00275447 predicted 3994
4 SASI_Mm01_00275448 predicted 2312
5 SASI_Mm01_00275449 predicted 2369
6 SASI_Mm01_00275450 predicted 2678
7 SASI_Mm01_00275451 predicted 3682
8 SASI_Mm01_00275452 predicted 2647
9 SASI_Mm01_00275453 predicted 3624
10 SASI_Mm01_00275454 predicted 2754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081366
VPS8 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 8 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081366.1-4816s21c1
Sequence:CCGGTAGTTCTACCCAGCCCTTTAGCTCGAGCTAAAGGGCTGGGTAGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081366.1-4794s21c1
Sequence:CCGGTCATTTCGCTCAGAATATTACCTCGAGGTAATATTCTGAGCGAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-2180s21c1
Sequence:CCGGGGAGTGCCTTGAGCCATATATCTCGAGATATATGGCTCAAGGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-2125s21c1
Sequence:CCGGTTGGTCAAATGTACGACAAATCTCGAGATTTGTCGTACATTTGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-558s21c1
Sequence:CCGGGACGATGAAGATGAGTCTTTCCTCGAGGAAAGACTCATCTTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-2984s21c1
Sequence:CCGGGGCCGGAGGCATAGTTCAATTCTCGAGAATTGAACTATGCCTCCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-1093s21c1
Sequence:CCGGATGATCCAACTCTTGCGATTTCTCGAGAAATCGCAAGAGTTGGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-3912s21c1
Sequence:CCGGATCTTGCAGGACCCAATTTATCTCGAGATAAATTGGGTCCTGCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-728s21c1
Sequence:CCGGTATGCGACATTCACTTCTAAACTCGAGTTTAGAAGTGAATGTCGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-4254s21c1
Sequence:CCGGCACAAATGCAGCTCAAGTAATCTCGAGATTACTTGAGCTGCATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081366
VPS8 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 8 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081366.1-4816s21c1
Sequence:CCGGTAGTTCTACCCAGCCCTTTAGCTCGAGCTAAAGGGCTGGGTAGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081366.1-4794s21c1
Sequence:CCGGTCATTTCGCTCAGAATATTACCTCGAGGTAATATTCTGAGCGAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-2180s21c1
Sequence:CCGGGGAGTGCCTTGAGCCATATATCTCGAGATATATGGCTCAAGGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-2125s21c1
Sequence:CCGGTTGGTCAAATGTACGACAAATCTCGAGATTTGTCGTACATTTGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-558s21c1
Sequence:CCGGGACGATGAAGATGAGTCTTTCCTCGAGGAAAGACTCATCTTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-2984s21c1
Sequence:CCGGGGCCGGAGGCATAGTTCAATTCTCGAGAATTGAACTATGCCTCCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-1093s21c1
Sequence:CCGGATGATCCAACTCTTGCGATTTCTCGAGAAATCGCAAGAGTTGGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-3912s21c1
Sequence:CCGGATCTTGCAGGACCCAATTTATCTCGAGATAAATTGGGTCCTGCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-728s21c1
Sequence:CCGGTATGCGACATTCACTTCTAAACTCGAGTTTAGAAGTGAATGTCGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-4254s21c1
Sequence:CCGGCACAAATGCAGCTCAAGTAATCTCGAGATTACTTGAGCTGCATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081366
VPS8 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 8 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081366.1-4816s21c1
Sequence:CCGGTAGTTCTACCCAGCCCTTTAGCTCGAGCTAAAGGGCTGGGTAGAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081366.1-4794s21c1
Sequence:CCGGTCATTTCGCTCAGAATATTACCTCGAGGTAATATTCTGAGCGAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-2180s21c1
Sequence:CCGGGGAGTGCCTTGAGCCATATATCTCGAGATATATGGCTCAAGGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-2125s21c1
Sequence:CCGGTTGGTCAAATGTACGACAAATCTCGAGATTTGTCGTACATTTGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-558s21c1
Sequence:CCGGGACGATGAAGATGAGTCTTTCCTCGAGGAAAGACTCATCTTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-2984s21c1
Sequence:CCGGGGCCGGAGGCATAGTTCAATTCTCGAGAATTGAACTATGCCTCCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-1093s21c1
Sequence:CCGGATGATCCAACTCTTGCGATTTCTCGAGAAATCGCAAGAGTTGGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-3912s21c1
Sequence:CCGGATCTTGCAGGACCCAATTTATCTCGAGATAAATTGGGTCCTGCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-728s21c1
Sequence:CCGGTATGCGACATTCACTTCTAAACTCGAGTTTAGAAGTGAATGTCGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081366.1-4254s21c1
Sequence:CCGGCACAAATGCAGCTCAAGTAATCTCGAGATTACTTGAGCTGCATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015303
VALIDATED
VPS8 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 8 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015303.3-4780s21c1
Sequence:CCGGGTAGGTGGAACTCACACAAATCTCGAGATTTGTGTGAGTTCCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015303.3-4734s21c1
Sequence:CCGGCATTTCGCCTATTGCGACTTTCTCGAGAAAGTCGCAATAGGCGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-3865s21c1
Sequence:CCGGCAAGATCTCCATTGGTCATTGCTCGAGCAATGACCAATGGAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-549s21c1
Sequence:CCGGTTCACTTCATGGATCAGTTATCTCGAGATAACTGATCCATGAAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-1905s21c1
Sequence:CCGGGGTGCCTGTCATAGTTGATTACTCGAGTAATCAACTATGACAGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-4070s21c1
Sequence:CCGGCAAGATGGACATGCTACAAATCTCGAGATTTGTAGCATGTCCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-501s21c1
Sequence:CCGGTGGTGACAGGACCAACTTAAACTCGAGTTTAAGTTGGTCCTGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-3280s21c1
Sequence:CCGGTTCAACCCAACCCAAGTTATACTCGAGTATAACTTGGGTTGGGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015303.2-4622s1c1
Sequence:CCGGCGTCAGTTCACCAGACTCATTCTCGAGAATGAGTCTGGTGAACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015303.2-3895s1c1
Sequence:CCGGCCAAACAAGATTACTGCTCTACTCGAGTAGAGCAGTAATCTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015303.2-1346s1c1
Sequence:CCGGCCTCATCAACTTTACCTGGATCTCGAGATCCAGGTAAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015303.2-4152s1c1
Sequence:CCGGCCATCGTATCATCAGTCCAAACTCGAGTTTGGACTGATGATACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015303.2-3468s1c1
Sequence:CCGGCCCTCATTGAAGGATGTTGAACTCGAGTTCAACATCCTTCAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015303
VALIDATED
VPS8 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 8 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015303.3-4780s21c1
Sequence:CCGGGTAGGTGGAACTCACACAAATCTCGAGATTTGTGTGAGTTCCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015303.3-4734s21c1
Sequence:CCGGCATTTCGCCTATTGCGACTTTCTCGAGAAAGTCGCAATAGGCGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-3865s21c1
Sequence:CCGGCAAGATCTCCATTGGTCATTGCTCGAGCAATGACCAATGGAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-549s21c1
Sequence:CCGGTTCACTTCATGGATCAGTTATCTCGAGATAACTGATCCATGAAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-1905s21c1
Sequence:CCGGGGTGCCTGTCATAGTTGATTACTCGAGTAATCAACTATGACAGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-4070s21c1
Sequence:CCGGCAAGATGGACATGCTACAAATCTCGAGATTTGTAGCATGTCCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-501s21c1
Sequence:CCGGTGGTGACAGGACCAACTTAAACTCGAGTTTAAGTTGGTCCTGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-3280s21c1
Sequence:CCGGTTCAACCCAACCCAAGTTATACTCGAGTATAACTTGGGTTGGGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015303.2-4622s1c1
Sequence:CCGGCGTCAGTTCACCAGACTCATTCTCGAGAATGAGTCTGGTGAACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015303.2-3895s1c1
Sequence:CCGGCCAAACAAGATTACTGCTCTACTCGAGTAGAGCAGTAATCTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015303.2-1346s1c1
Sequence:CCGGCCTCATCAACTTTACCTGGATCTCGAGATCCAGGTAAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015303.2-4152s1c1
Sequence:CCGGCCATCGTATCATCAGTCCAAACTCGAGTTTGGACTGATGATACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015303.2-3468s1c1
Sequence:CCGGCCCTCATTGAAGGATGTTGAACTCGAGTTCAACATCCTTCAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015303
VALIDATED
VPS8 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 8 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015303.3-4780s21c1
Sequence:CCGGGTAGGTGGAACTCACACAAATCTCGAGATTTGTGTGAGTTCCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015303.3-4734s21c1
Sequence:CCGGCATTTCGCCTATTGCGACTTTCTCGAGAAAGTCGCAATAGGCGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-3865s21c1
Sequence:CCGGCAAGATCTCCATTGGTCATTGCTCGAGCAATGACCAATGGAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-549s21c1
Sequence:CCGGTTCACTTCATGGATCAGTTATCTCGAGATAACTGATCCATGAAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-1905s21c1
Sequence:CCGGGGTGCCTGTCATAGTTGATTACTCGAGTAATCAACTATGACAGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-4070s21c1
Sequence:CCGGCAAGATGGACATGCTACAAATCTCGAGATTTGTAGCATGTCCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-501s21c1
Sequence:CCGGTGGTGACAGGACCAACTTAAACTCGAGTTTAAGTTGGTCCTGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015303.3-3280s21c1
Sequence:CCGGTTCAACCCAACCCAAGTTATACTCGAGTATAACTTGGGTTGGGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015303.2-4622s1c1
Sequence:CCGGCGTCAGTTCACCAGACTCATTCTCGAGAATGAGTCTGGTGAACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015303.2-3895s1c1
Sequence:CCGGCCAAACAAGATTACTGCTCTACTCGAGTAGAGCAGTAATCTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015303.2-1346s1c1
Sequence:CCGGCCTCATCAACTTTACCTGGATCTCGAGATCCAGGTAAAGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015303.2-4152s1c1
Sequence:CCGGCCATCGTATCATCAGTCCAAACTCGAGTTTGGACTGATGATACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015303.2-3468s1c1
Sequence:CCGGCCCTCATTGAAGGATGTTGAACTCGAGTTCAACATCCTTCAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145948
VALIDATED
VPS8 MISSION shRNA Bacterial Glycerol Stock
vacuolar protein sorting 8 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-2098s1c1
Sequence:CCGGCCAGAGAAATTCACAGAATTTCTCGAGAAATTCTGTGAATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-2522s1c1
Sequence:CCGGCGCCAAGAAATGGCTGATGAACTCGAGTTCATCAGCCATTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-1023s1c1
Sequence:CCGGCCGAGGAAGAAGTCTATCCTTCTCGAGAAGGATAGACTTCTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145948.2-868s1c1
Sequence:CCGGGCAAGTTGTTATGGGCAACAACTCGAGTTGTTGCCCATAACAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-1370s1c1
Sequence:CCGGGCCGGAGGCATAGTTCAATTTCTCGAGAAATTGAACTATGCCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145948
VALIDATED
VPS8 MISSION shRNA shRNA Plasmid DNA
vacuolar protein sorting 8 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-2098s1c1
Sequence:CCGGCCAGAGAAATTCACAGAATTTCTCGAGAAATTCTGTGAATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-2522s1c1
Sequence:CCGGCGCCAAGAAATGGCTGATGAACTCGAGTTCATCAGCCATTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-1023s1c1
Sequence:CCGGCCGAGGAAGAAGTCTATCCTTCTCGAGAAGGATAGACTTCTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145948.2-868s1c1
Sequence:CCGGGCAAGTTGTTATGGGCAACAACTCGAGTTGTTGCCCATAACAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-1370s1c1
Sequence:CCGGGCCGGAGGCATAGTTCAATTTCTCGAGAAATTGAACTATGCCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145948
VALIDATED
VPS8 MISSION shRNA Lentiviral Transduction Particles
vacuolar protein sorting 8 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-2098s1c1
Sequence:CCGGCCAGAGAAATTCACAGAATTTCTCGAGAAATTCTGTGAATTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-2522s1c1
Sequence:CCGGCGCCAAGAAATGGCTGATGAACTCGAGTTCATCAGCCATTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-1023s1c1
Sequence:CCGGCCGAGGAAGAAGTCTATCCTTCTCGAGAAGGATAGACTTCTTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145948.2-868s1c1
Sequence:CCGGGCAAGTTGTTATGGGCAACAACTCGAGTTGTTGCCCATAACAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145948.2-1370s1c1
Sequence:CCGGGCCGGAGGCATAGTTCAATTTCTCGAGAAATTGAACTATGCCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks