EMAIL THIS PAGE TO A FRIEND

VPS9D1

VPS9 domain containing 1

Synonyms: ATP-BL C16orf7
UniProtKB ID: Q9Y2B5
Gene ID:
Mouse(72325) VPS9 domain containing 1
Rat(307923) VPS9 domain containing 1
Zebrafish(503773) VPS9 domain containing 1
domestic cat(101083226) VPS9 domain containing 1
dog(608726) VPS9 domain containing 1
domestic guinea pig(100732050) VPS9 domain containing 1
naked mole-rat(101698811) VPS9 domain containing 1
cow(514538) VPS9 domain containing 1
sheep(101111482) VPS9 domain containing 1
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004913 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004913 Rosetta Predictions human pricing
NM_001107440 Rosetta Predictions rat pricing
XM_902711 Rosetta Predictions mouse pricing
XM_925142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155980 predicted 235
2 SASI_Hs01_00155981 predicted 232
3 SASI_Hs01_00155982 predicted 1449
4 SASI_Hs01_00155983 predicted 246
5 SASI_Hs01_00155984 predicted 1545
6 SASI_Hs02_00338575 predicted 2087
7 SASI_Hs01_00155986 predicted 1453
8 SASI_Hs02_00338576 predicted 335
9 SASI_Hs01_00155989 predicted 872
10 SASI_Hs02_00338577 predicted 688
11 SASI_Hs01_00155985 predicted 387
12 SASI_Hs01_00155987 predicted 1059
13 SASI_Hs01_00155988 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228845 predicted 226
2 SASI_Rn02_00228846 predicted 437
3 SASI_Rn02_00228847 predicted 909
4 SASI_Rn02_00228848 predicted 1065
5 SASI_Rn02_00228849 predicted 1143
6 SASI_Rn02_00228850 predicted 268
7 SASI_Rn02_00228851 predicted 455
8 SASI_Rn02_00228852 predicted 606
9 SASI_Rn02_00228853 predicted 413
10 SASI_Rn02_00228854 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203168 predicted 1700
2 SASI_Mm01_00203169 predicted 664
3 SASI_Mm01_00203170 predicted 1125
4 SASI_Mm01_00203171 predicted 1068
5 SASI_Mm02_00430251 predicted 976
6 SASI_Mm01_00203173 predicted 2450
7 SASI_Mm01_00203174 predicted 1257
8 SASI_Mm01_00203175 predicted 1666
9 SASI_Mm01_00203176 predicted 1153
10 SASI_Mm02_00430252 predicted 1061
11 SASI_Mm01_00203172 predicted 575
12 SASI_Mm01_00203177 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444473 predicted 1707
2 SASI_Mm02_00444474 predicted 666
3 SASI_Mm02_00444475 predicted 1579
4 SASI_Mm02_00444476 predicted 1256
5 SASI_Mm02_00444477 predicted 1663
6 SASI_Mm02_00444478 predicted 2289
7 SASI_Mm02_00444479 predicted 623
8 SASI_Mm02_00444480 predicted 1715
9 SASI_Mm02_00444481 predicted 981
10 SASI_Mm02_00444482 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004913
VPS9D1 MISSION shRNA Bacterial Glycerol Stock
VPS9 domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-578s1c1
Sequence:CCGGGAGTCACAAAGCTGTAAGAAACTCGAGTTTCTTACAGCTTTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-737s1c1
Sequence:CCGGGAGAACCTAGTGATTGCCAAACTCGAGTTTGGCAATCACTAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-270s1c1
Sequence:CCGGCATACACGGAATACCTGAGGACTCGAGTCCTCAGGTATTCCGTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-201s1c1
Sequence:CCGGGCCGGAATAATGGAGTCACTTCTCGAGAAGTGACTCCATTATTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-323s1c1
Sequence:CCGGGAAGTGGAAACCACTAAAGAACTCGAGTTCTTTAGTGGTTTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004913.2-1739s21c1
Sequence:CCGGCATCTGTGTCTGTGCGGAAGACTCGAGTCTTCCGCACAGACACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004913.2-2333s21c1
Sequence:CCGGTGCAGGCTCAGCGATGAACATCTCGAGATGTTCATCGCTGAGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004913
VPS9D1 MISSION shRNA shRNA Plasmid DNA
VPS9 domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-578s1c1
Sequence:CCGGGAGTCACAAAGCTGTAAGAAACTCGAGTTTCTTACAGCTTTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-737s1c1
Sequence:CCGGGAGAACCTAGTGATTGCCAAACTCGAGTTTGGCAATCACTAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-270s1c1
Sequence:CCGGCATACACGGAATACCTGAGGACTCGAGTCCTCAGGTATTCCGTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-201s1c1
Sequence:CCGGGCCGGAATAATGGAGTCACTTCTCGAGAAGTGACTCCATTATTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-323s1c1
Sequence:CCGGGAAGTGGAAACCACTAAAGAACTCGAGTTCTTTAGTGGTTTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004913.2-1739s21c1
Sequence:CCGGCATCTGTGTCTGTGCGGAAGACTCGAGTCTTCCGCACAGACACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004913.2-2333s21c1
Sequence:CCGGTGCAGGCTCAGCGATGAACATCTCGAGATGTTCATCGCTGAGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004913
VPS9D1 MISSION shRNA Lentiviral Transduction Particles
VPS9 domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-578s1c1
Sequence:CCGGGAGTCACAAAGCTGTAAGAAACTCGAGTTTCTTACAGCTTTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-737s1c1
Sequence:CCGGGAGAACCTAGTGATTGCCAAACTCGAGTTTGGCAATCACTAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-270s1c1
Sequence:CCGGCATACACGGAATACCTGAGGACTCGAGTCCTCAGGTATTCCGTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-201s1c1
Sequence:CCGGGCCGGAATAATGGAGTCACTTCTCGAGAAGTGACTCCATTATTCCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004913.1-323s1c1
Sequence:CCGGGAAGTGGAAACCACTAAAGAACTCGAGTTCTTTAGTGGTTTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004913.2-1739s21c1
Sequence:CCGGCATCTGTGTCTGTGCGGAAGACTCGAGTCTTCCGCACAGACACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004913.2-2333s21c1
Sequence:CCGGTGCAGGCTCAGCGATGAACATCTCGAGATGTTCATCGCTGAGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028200
VALIDATED
VPS9D1 MISSION shRNA Bacterial Glycerol Stock
VPS9 domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028200.1-2342s21c1
Sequence:CCGGTCAGCACAGAAATGGGTATTGCTCGAGCAATACCCATTTCTGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028200.1-346s21c1
Sequence:CCGGCTACCAAGCTTGGGAGAATATCTCGAGATATTCTCCCAAGCTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028200.1-956s21c1
Sequence:CCGGGAAGCTGCAGTGTGCGGTATACTCGAGTATACCGCACACTGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028200.1-1952s21c1
Sequence:CCGGGATTGGAGAAGAAGGGTATTGCTCGAGCAATACCCTTCTTCTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028200.1-558s21c1
Sequence:CCGGCAGAAGCTGAGGGCCACATATCTCGAGATATGTGGCCCTCAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028200
VALIDATED
VPS9D1 MISSION shRNA shRNA Plasmid DNA
VPS9 domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028200.1-2342s21c1
Sequence:CCGGTCAGCACAGAAATGGGTATTGCTCGAGCAATACCCATTTCTGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028200.1-346s21c1
Sequence:CCGGCTACCAAGCTTGGGAGAATATCTCGAGATATTCTCCCAAGCTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028200.1-956s21c1
Sequence:CCGGGAAGCTGCAGTGTGCGGTATACTCGAGTATACCGCACACTGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028200.1-1952s21c1
Sequence:CCGGGATTGGAGAAGAAGGGTATTGCTCGAGCAATACCCTTCTTCTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028200.1-558s21c1
Sequence:CCGGCAGAAGCTGAGGGCCACATATCTCGAGATATGTGGCCCTCAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028200
VALIDATED
VPS9D1 MISSION shRNA Lentiviral Transduction Particles
VPS9 domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028200.1-2342s21c1
Sequence:CCGGTCAGCACAGAAATGGGTATTGCTCGAGCAATACCCATTTCTGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028200.1-346s21c1
Sequence:CCGGCTACCAAGCTTGGGAGAATATCTCGAGATATTCTCCCAAGCTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028200.1-956s21c1
Sequence:CCGGGAAGCTGCAGTGTGCGGTATACTCGAGTATACCGCACACTGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028200.1-1952s21c1
Sequence:CCGGGATTGGAGAAGAAGGGTATTGCTCGAGCAATACCCTTCTTCTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028200.1-558s21c1
Sequence:CCGGCAGAAGCTGAGGGCCACATATCTCGAGATATGTGGCCCTCAGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks