EMAIL THIS PAGE TO A FRIEND

VRK1

vaccinia related kinase 1

Synonyms: PCH1 PCH1A
UniProtKB ID: Q99986, Q3SYL2
Gene ID:
Human(7443) Summary: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. [provided by RefSeq, Jul 2008]
Mouse(22367) vaccinia related kinase 1
Rat(362779) vaccinia related kinase 1
Zebrafish(406694) vaccinia related kinase 1
chicken(423443) vaccinia related kinase 1
dog(490848) vaccinia related kinase 1
domestic cat(101091879) vaccinia related kinase 1
cow(618880) vaccinia related kinase 1
sheep(101122310) vaccinia related kinase 1
naked mole-rat(101713744) vaccinia related kinase 1
domestic guinea pig(100728382) vaccinia related kinase 1
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003384 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003384 Rosetta Predictions human pricing
NM_001012194 Rosetta Predictions rat pricing
XM_576097 Rosetta Predictions rat pricing
NM_001029843 Rosetta Predictions mouse pricing
NM_001029844 Rosetta Predictions mouse pricing
NM_011705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073471 predicted 873
2 SASI_Hs01_00073472 predicted 590
3 SASI_Hs01_00073473 predicted 286
4 SASI_Hs01_00073474 predicted 246
5 SASI_Hs01_00073475 predicted 992
6 SASI_Hs01_00073476 predicted 838
7 SASI_Hs01_00073477 predicted 1019
8 SASI_Hs01_00073478 predicted 598
9 SASI_Hs01_00073479 predicted 573
10 SASI_Hs02_00335554 predicted 353
11 SASI_Hs01_00073480 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043414 predicted 752
2 SASI_Rn01_00043415 predicted 1142
3 SASI_Rn01_00043416 predicted 596
4 SASI_Rn01_00043417 predicted 1528
5 SASI_Rn01_00043418 predicted 589
6 SASI_Rn01_00043419 predicted 864
7 SASI_Rn01_00043420 predicted 1488
8 SASI_Rn01_00043421 predicted 372
9 SASI_Rn01_00043422 predicted 1023
10 SASI_Rn01_00043423 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153516 predicted 1194
2 SASI_Rn01_00153517 predicted 1589
3 SASI_Rn01_00153518 predicted 1044
4 SASI_Rn01_00153519 predicted 1984
5 SASI_Rn01_00153520 predicted 1032
6 SASI_Rn01_00153521 predicted 1321
7 SASI_Rn01_00153522 predicted 1947
8 SASI_Rn01_00153523 predicted 1643
9 SASI_Rn01_00153524 predicted 1473
10 SASI_Rn01_00153525 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072097 predicted 901
2 SASI_Mm01_00072098 predicted 932
3 SASI_Mm01_00072099 predicted 833
4 SASI_Mm01_00072100 predicted 944
5 SASI_Mm02_00288018 predicted 467
6 SASI_Mm01_00072101 predicted 364
7 SASI_Mm01_00072103 predicted 404
8 SASI_Mm01_00072104 predicted 244
9 SASI_Mm01_00072105 predicted 674
10 SASI_Mm01_00072106 predicted 409
11 SASI_Mm01_00072102 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043471 predicted 902
2 SASI_Mm01_00043472 predicted 936
3 SASI_Mm01_00043473 predicted 827
4 SASI_Mm01_00043474 predicted 945
5 SASI_Mm02_00288019 predicted 474
6 SASI_Mm01_00043475 predicted 367
7 SASI_Mm01_00043477 predicted 403
8 SASI_Mm01_00043478 predicted 251
9 SASI_Mm01_00043479 predicted 668
10 SASI_Mm01_00043480 predicted 412
11 SASI_Mm01_00043476 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109173 predicted 898
2 SASI_Mm01_00109174 predicted 928
3 SASI_Mm01_00109175 predicted 831
4 SASI_Mm01_00109176 predicted 941
5 SASI_Mm02_00321266 predicted 473
6 SASI_Mm01_00109177 predicted 361
7 SASI_Mm01_00109179 predicted 403
8 SASI_Mm01_00109180 predicted 247
9 SASI_Mm01_00109181 predicted 670
10 SASI_Mm01_00109182 predicted 409
11 SASI_Mm01_00109178 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011705
VALIDATED
VRK1 MISSION shRNA Bacterial Glycerol Stock
vaccinia related kinase 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-421s21c1
Sequence:CCGGACCTTGGTGTTCCTAAGTATTCTCGAGAATACTTAGGAACACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-443s21c1
Sequence:CCGGGGGATCTGGTCTACATGATAACTCGAGTTATCATGTAGACCAGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-664s21c1
Sequence:CCGGAGAACCCTGACCAGGTATATTCTCGAGAATATACCTGGTCAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011705.3-395s21c1
Sequence:CCGGATGGATTCGTACACATAAATTCTCGAGAATTTATGTGTACGAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-559s21c1
Sequence:CCGGCTGTATTGCAGCTAAGCTTAACTCGAGTTAAGCTTAGCTGCAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011705.3-1581s21c1
Sequence:CCGGACTTTACTGAAGGGTAATTTACTCGAGTAAATTACCCTTCAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-1413s21c1
Sequence:CCGGGCCCAGAAGTAAACGAGATTCCTCGAGGAATCTCGTTTACTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011705.3-1609s21c1
Sequence:CCGGCTGAATCTTTAGTCGTCATAACTCGAGTTATGACGACTAAAGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-276s1c1
Sequence:CCGGCCAGTGACAATGGACCTCTTTCTCGAGAAAGAGGTCCATTGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-254s1c1
Sequence:CCGGCCCTGTGTTGTGAAAGTGGAACTCGAGTTCCACTTTCACAACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-833s1c1
Sequence:CCGGCCTTGGGAAGATAACTTGAAACTCGAGTTTCAAGTTATCTTCCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-1311s1c1
Sequence:CCGGGATTGGAACAAGACATGCTAACTCGAGTTAGCATGTCTTGTTCCAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-766s1c1
Sequence:CCGGCCCATCAAGACGTGGTGATTTCTCGAGAAATCACCACGTCTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011705
VALIDATED
VRK1 MISSION shRNA shRNA Plasmid DNA
vaccinia related kinase 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-421s21c1
Sequence:CCGGACCTTGGTGTTCCTAAGTATTCTCGAGAATACTTAGGAACACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-443s21c1
Sequence:CCGGGGGATCTGGTCTACATGATAACTCGAGTTATCATGTAGACCAGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-664s21c1
Sequence:CCGGAGAACCCTGACCAGGTATATTCTCGAGAATATACCTGGTCAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011705.3-395s21c1
Sequence:CCGGATGGATTCGTACACATAAATTCTCGAGAATTTATGTGTACGAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-559s21c1
Sequence:CCGGCTGTATTGCAGCTAAGCTTAACTCGAGTTAAGCTTAGCTGCAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011705.3-1581s21c1
Sequence:CCGGACTTTACTGAAGGGTAATTTACTCGAGTAAATTACCCTTCAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-1413s21c1
Sequence:CCGGGCCCAGAAGTAAACGAGATTCCTCGAGGAATCTCGTTTACTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011705.3-1609s21c1
Sequence:CCGGCTGAATCTTTAGTCGTCATAACTCGAGTTATGACGACTAAAGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-276s1c1
Sequence:CCGGCCAGTGACAATGGACCTCTTTCTCGAGAAAGAGGTCCATTGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-254s1c1
Sequence:CCGGCCCTGTGTTGTGAAAGTGGAACTCGAGTTCCACTTTCACAACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-833s1c1
Sequence:CCGGCCTTGGGAAGATAACTTGAAACTCGAGTTTCAAGTTATCTTCCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-1311s1c1
Sequence:CCGGGATTGGAACAAGACATGCTAACTCGAGTTAGCATGTCTTGTTCCAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-766s1c1
Sequence:CCGGCCCATCAAGACGTGGTGATTTCTCGAGAAATCACCACGTCTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011705
VALIDATED
VRK1 MISSION shRNA Lentiviral Transduction Particles
vaccinia related kinase 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-421s21c1
Sequence:CCGGACCTTGGTGTTCCTAAGTATTCTCGAGAATACTTAGGAACACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-443s21c1
Sequence:CCGGGGGATCTGGTCTACATGATAACTCGAGTTATCATGTAGACCAGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-664s21c1
Sequence:CCGGAGAACCCTGACCAGGTATATTCTCGAGAATATACCTGGTCAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011705.3-395s21c1
Sequence:CCGGATGGATTCGTACACATAAATTCTCGAGAATTTATGTGTACGAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-559s21c1
Sequence:CCGGCTGTATTGCAGCTAAGCTTAACTCGAGTTAAGCTTAGCTGCAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011705.3-1581s21c1
Sequence:CCGGACTTTACTGAAGGGTAATTTACTCGAGTAAATTACCCTTCAGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011705.3-1413s21c1
Sequence:CCGGGCCCAGAAGTAAACGAGATTCCTCGAGGAATCTCGTTTACTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011705.3-1609s21c1
Sequence:CCGGCTGAATCTTTAGTCGTCATAACTCGAGTTATGACGACTAAAGATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-276s1c1
Sequence:CCGGCCAGTGACAATGGACCTCTTTCTCGAGAAAGAGGTCCATTGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-254s1c1
Sequence:CCGGCCCTGTGTTGTGAAAGTGGAACTCGAGTTCCACTTTCACAACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-833s1c1
Sequence:CCGGCCTTGGGAAGATAACTTGAAACTCGAGTTTCAAGTTATCTTCCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-1311s1c1
Sequence:CCGGGATTGGAACAAGACATGCTAACTCGAGTTAGCATGTCTTGTTCCAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011705.2-766s1c1
Sequence:CCGGCCCATCAAGACGTGGTGATTTCTCGAGAAATCACCACGTCTTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003384
VALIDATED
VRK1 MISSION shRNA Bacterial Glycerol Stock
vaccinia related kinase 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-1101s21c1
Sequence:CCGGGAAGTAAGGATGATGGCAAATCTCGAGATTTGCCATCATCCTTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-789s21c1
Sequence:CCGGCGAGCATCGATGCACACAATGCTCGAGCATTGTGTGCATCGATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-692s21c1
Sequence:CCGGGTAGATTATGGCCTTGCTTATCTCGAGATAAGCAAGGCCATAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-633s21c1
Sequence:CCGGGAGATATCAAGGCCTCAAATCCTCGAGGATTTGAGGCCTTGATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003384.2-1391s21c1
Sequence:CCGGGCGAGGTGGAAGTAATGATTACTCGAGTAATCATTACTTCCACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003384.x-1488s1c1
Sequence:CCGGGTTATCCCAAAGCCGTGTGTTCTCGAGAACACACGGCTTTGGGATAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.x-1070s1c1
Sequence:CCGGGAAGTAAGGATGATGGCAAATCTCGAGATTTGCCATCATCCTTACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003384.x-155s1c1
Sequence:CCGGAGATAATAACTGACATGGCAACTCGAGTTGCCATGTCAGTTATTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.x-1177s1c1
Sequence:CCGGCCTGGTGTTGAAGATACGGAACTCGAGTTCCGTATCTTCAACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003384.2-1380s1c1
Sequence:CCGGCTGTGAGTCTTGCGAGGTGGACTCGAGTCCACCTCGCAAGACTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003384.2-908s1c1
Sequence:CCGGCCTAAATATGTTAGAGATTCCCTCGAGGGAATCTCTAACATATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003384.2-993s1c1
Sequence:CCGGCAGGTGAAATTGCCAAATACACTCGAGTGTATTTGGCAATTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003384.2-165s1c1
Sequence:CCGGCAGAACAATTTGCAGTTGGAGCTCGAGCTCCAACTGCAAATTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.2-633s1c1
Sequence:CCGGGAGATATCAAGGCCTCAAATCCTCGAGGATTTGAGGCCTTGATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.2-789s1c1
Sequence:CCGGCGAGCATCGATGCACACAATGCTCGAGCATTGTGTGCATCGATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003384
VALIDATED
VRK1 MISSION shRNA shRNA Plasmid DNA
vaccinia related kinase 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-1101s21c1
Sequence:CCGGGAAGTAAGGATGATGGCAAATCTCGAGATTTGCCATCATCCTTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-789s21c1
Sequence:CCGGCGAGCATCGATGCACACAATGCTCGAGCATTGTGTGCATCGATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-692s21c1
Sequence:CCGGGTAGATTATGGCCTTGCTTATCTCGAGATAAGCAAGGCCATAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-633s21c1
Sequence:CCGGGAGATATCAAGGCCTCAAATCCTCGAGGATTTGAGGCCTTGATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003384.2-1391s21c1
Sequence:CCGGGCGAGGTGGAAGTAATGATTACTCGAGTAATCATTACTTCCACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003384.x-1488s1c1
Sequence:CCGGGTTATCCCAAAGCCGTGTGTTCTCGAGAACACACGGCTTTGGGATAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.x-1070s1c1
Sequence:CCGGGAAGTAAGGATGATGGCAAATCTCGAGATTTGCCATCATCCTTACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003384.x-155s1c1
Sequence:CCGGAGATAATAACTGACATGGCAACTCGAGTTGCCATGTCAGTTATTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.x-1177s1c1
Sequence:CCGGCCTGGTGTTGAAGATACGGAACTCGAGTTCCGTATCTTCAACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003384.2-1380s1c1
Sequence:CCGGCTGTGAGTCTTGCGAGGTGGACTCGAGTCCACCTCGCAAGACTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003384.2-908s1c1
Sequence:CCGGCCTAAATATGTTAGAGATTCCCTCGAGGGAATCTCTAACATATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003384.2-993s1c1
Sequence:CCGGCAGGTGAAATTGCCAAATACACTCGAGTGTATTTGGCAATTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003384.2-165s1c1
Sequence:CCGGCAGAACAATTTGCAGTTGGAGCTCGAGCTCCAACTGCAAATTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.2-633s1c1
Sequence:CCGGGAGATATCAAGGCCTCAAATCCTCGAGGATTTGAGGCCTTGATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.2-789s1c1
Sequence:CCGGCGAGCATCGATGCACACAATGCTCGAGCATTGTGTGCATCGATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003384
VALIDATED
VRK1 MISSION shRNA Lentiviral Transduction Particles
vaccinia related kinase 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-1101s21c1
Sequence:CCGGGAAGTAAGGATGATGGCAAATCTCGAGATTTGCCATCATCCTTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-789s21c1
Sequence:CCGGCGAGCATCGATGCACACAATGCTCGAGCATTGTGTGCATCGATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-692s21c1
Sequence:CCGGGTAGATTATGGCCTTGCTTATCTCGAGATAAGCAAGGCCATAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003384.2-633s21c1
Sequence:CCGGGAGATATCAAGGCCTCAAATCCTCGAGGATTTGAGGCCTTGATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003384.2-1391s21c1
Sequence:CCGGGCGAGGTGGAAGTAATGATTACTCGAGTAATCATTACTTCCACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003384.x-1488s1c1
Sequence:CCGGGTTATCCCAAAGCCGTGTGTTCTCGAGAACACACGGCTTTGGGATAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.x-1070s1c1
Sequence:CCGGGAAGTAAGGATGATGGCAAATCTCGAGATTTGCCATCATCCTTACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003384.x-155s1c1
Sequence:CCGGAGATAATAACTGACATGGCAACTCGAGTTGCCATGTCAGTTATTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.x-1177s1c1
Sequence:CCGGCCTGGTGTTGAAGATACGGAACTCGAGTTCCGTATCTTCAACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003384.2-1380s1c1
Sequence:CCGGCTGTGAGTCTTGCGAGGTGGACTCGAGTCCACCTCGCAAGACTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003384.2-908s1c1
Sequence:CCGGCCTAAATATGTTAGAGATTCCCTCGAGGGAATCTCTAACATATTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003384.2-993s1c1
Sequence:CCGGCAGGTGAAATTGCCAAATACACTCGAGTGTATTTGGCAATTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003384.2-165s1c1
Sequence:CCGGCAGAACAATTTGCAGTTGGAGCTCGAGCTCCAACTGCAAATTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.2-633s1c1
Sequence:CCGGGAGATATCAAGGCCTCAAATCCTCGAGGATTTGAGGCCTTGATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003384.2-789s1c1
Sequence:CCGGCGAGCATCGATGCACACAATGCTCGAGCATTGTGTGCATCGATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks