EMAIL THIS PAGE TO A FRIEND

VRK2

vaccinia related kinase 2

Gene ID:
Human(7444) Summary: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, leukocytes, fetal liver, and carcinomas. Its protein localizes to the endoplasmic reticulum and has been shown to phosphorylate casein and undergo autophosphorylation. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(69922) vaccinia related kinase 2
Rat(360991) vaccinia related kinase 2
domestic guinea pig(100736194) vaccinia related kinase 2
naked mole-rat(101702519) vaccinia related kinase 2
Domestic Rabbit(100345223) vaccinia related kinase 2
cow(523902) vaccinia related kinase 2
Zebrafish(394145) vaccinia related kinase 2
chicken(100857144) vaccinia related kinase 2
dog(474605) vaccinia related kinase 2
domestic cat(101098217) vaccinia related kinase 2
Horse(100052238) vaccinia related kinase 2
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006296 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070731 MISSION® esiRNA esiRNA human VRK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006296 siRNAs that have been validated in the lab human pricing
NM_001108366 Rosetta Predictions rat pricing
NM_027260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006296 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242105 validated 1676
1 SASI_Hs01_00242104 validated 860
2 SASI_Hs02_00341301 predicted 879
3 SASI_Hs01_00242106 predicted 843
4 SASI_Hs01_00242107 predicted 665
5 SASI_Hs01_00242108 predicted 629
6 SASI_Hs01_00242109 predicted 1103
7 SASI_Hs01_00242110 predicted 824
8 SASI_Hs01_00242111 predicted 401
9 SASI_Hs01_00242112 predicted 748
10 SASI_Hs01_00242113 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237959 predicted 344
2 SASI_Rn02_00237960 predicted 415
3 SASI_Rn02_00237961 predicted 520
4 SASI_Rn02_00237962 predicted 579
5 SASI_Rn02_00237963 predicted 395
6 SASI_Rn02_00237964 predicted 751
7 SASI_Rn02_00237965 predicted 745
8 SASI_Rn02_00237966 predicted 403
9 SASI_Rn02_00237967 predicted 506
10 SASI_Rn02_00237968 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093672 predicted 607
2 SASI_Mm01_00093673 predicted 681
3 SASI_Mm02_00331838 predicted 450
4 SASI_Mm01_00093674 predicted 888
5 SASI_Mm01_00093676 predicted 842
6 SASI_Mm01_00093677 predicted 1583
7 SASI_Mm01_00093678 predicted 812
8 SASI_Mm02_00331839 predicted 347
9 SASI_Mm02_00331840 predicted 789
10 SASI_Mm01_00093679 predicted 510
11 SASI_Mm01_00093675 predicted 919
12 SASI_Mm01_00093680 predicted 885
13 SASI_Mm01_00093681 predicted 1272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006296
VALIDATED
VRK2 MISSION shRNA Bacterial Glycerol Stock
vaccinia related kinase 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-684s1c1
Sequence:CCGGCAGGCCAGAATGGTACCTTTACTCGAGTAAAGGTACCATTCTGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-1859s1c1
Sequence:CCGGGCTCTTCACCGAAATGTTGTACTCGAGTACAACATTTCGGTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-1172s1c1
Sequence:CCGGGCTCATAGTTTAGCATATGATCTCGAGATCATATGCTAAACTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006296.3-1626s1c1
Sequence:CCGGGATCTCCATCTTGGTATAAATCTCGAGATTTATACCAAGATGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006296.3-1882s1c1
Sequence:CCGGCTTATTTCAGTGTTTCCTTCCCTCGAGGGAAGGAAACACTGAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-399s1c1
Sequence:CCGGCTGGAGGATTTGGATTGATATCTCGAGATATCAATCCAAATCCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-1865s1c1
Sequence:CCGGCACCGAAATGTTGTATTCTTACTCGAGTAAGAATACAACATTTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-1039s1c1
Sequence:CCGGGCCAAACTATCAAGCCCTCAACTCGAGTTGAGGGCTTGATAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-466s1c1
Sequence:CCGGGGGAAGAAGTTACAGATTTATCTCGAGATAAATCTGTAACTTCTTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-1193s1c1
Sequence:CCGGGCACACAATAGGTTAATCGAACTCGAGTTCGATTAACCTATTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-580s1c1
Sequence:CCGGGTTGGATGTACTGGAATATATCTCGAGATATATTCCAGTACATCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006296.x-723s1c1
Sequence:CCGGACCACAAACAGTATCAGGAAACTCGAGTTTCCTGATACTGTTTGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-390s21c1
Sequence:CCGGCTGGAGGATTTGGATTGATATCTCGAGATATCAATCCAAATCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-1189s21c1
Sequence:CCGGGCCAAACTATCAAGCCCTCAACTCGAGTTGAGGGCTTGATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-730s21c1
Sequence:CCGGGTTGGATGTACTGGAATATATCTCGAGATATATTCCAGTACATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-616s21c1
Sequence:CCGGGGGAAGAAGTTACAGATTTATCTCGAGATAAATCTGTAACTTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006296
VALIDATED
VRK2 MISSION shRNA shRNA Plasmid DNA
vaccinia related kinase 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-684s1c1
Sequence:CCGGCAGGCCAGAATGGTACCTTTACTCGAGTAAAGGTACCATTCTGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-1859s1c1
Sequence:CCGGGCTCTTCACCGAAATGTTGTACTCGAGTACAACATTTCGGTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-1172s1c1
Sequence:CCGGGCTCATAGTTTAGCATATGATCTCGAGATCATATGCTAAACTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006296.3-1626s1c1
Sequence:CCGGGATCTCCATCTTGGTATAAATCTCGAGATTTATACCAAGATGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006296.3-1882s1c1
Sequence:CCGGCTTATTTCAGTGTTTCCTTCCCTCGAGGGAAGGAAACACTGAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-399s1c1
Sequence:CCGGCTGGAGGATTTGGATTGATATCTCGAGATATCAATCCAAATCCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-1865s1c1
Sequence:CCGGCACCGAAATGTTGTATTCTTACTCGAGTAAGAATACAACATTTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-1039s1c1
Sequence:CCGGGCCAAACTATCAAGCCCTCAACTCGAGTTGAGGGCTTGATAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-466s1c1
Sequence:CCGGGGGAAGAAGTTACAGATTTATCTCGAGATAAATCTGTAACTTCTTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-1193s1c1
Sequence:CCGGGCACACAATAGGTTAATCGAACTCGAGTTCGATTAACCTATTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-580s1c1
Sequence:CCGGGTTGGATGTACTGGAATATATCTCGAGATATATTCCAGTACATCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006296.x-723s1c1
Sequence:CCGGACCACAAACAGTATCAGGAAACTCGAGTTTCCTGATACTGTTTGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-390s21c1
Sequence:CCGGCTGGAGGATTTGGATTGATATCTCGAGATATCAATCCAAATCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-1189s21c1
Sequence:CCGGGCCAAACTATCAAGCCCTCAACTCGAGTTGAGGGCTTGATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-730s21c1
Sequence:CCGGGTTGGATGTACTGGAATATATCTCGAGATATATTCCAGTACATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-616s21c1
Sequence:CCGGGGGAAGAAGTTACAGATTTATCTCGAGATAAATCTGTAACTTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006296
VALIDATED
VRK2 MISSION shRNA Lentiviral Transduction Particles
vaccinia related kinase 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-684s1c1
Sequence:CCGGCAGGCCAGAATGGTACCTTTACTCGAGTAAAGGTACCATTCTGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-1859s1c1
Sequence:CCGGGCTCTTCACCGAAATGTTGTACTCGAGTACAACATTTCGGTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-1172s1c1
Sequence:CCGGGCTCATAGTTTAGCATATGATCTCGAGATCATATGCTAAACTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006296.3-1626s1c1
Sequence:CCGGGATCTCCATCTTGGTATAAATCTCGAGATTTATACCAAGATGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006296.3-1882s1c1
Sequence:CCGGCTTATTTCAGTGTTTCCTTCCCTCGAGGGAAGGAAACACTGAAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-399s1c1
Sequence:CCGGCTGGAGGATTTGGATTGATATCTCGAGATATCAATCCAAATCCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.3-1865s1c1
Sequence:CCGGCACCGAAATGTTGTATTCTTACTCGAGTAAGAATACAACATTTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-1039s1c1
Sequence:CCGGGCCAAACTATCAAGCCCTCAACTCGAGTTGAGGGCTTGATAGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-466s1c1
Sequence:CCGGGGGAAGAAGTTACAGATTTATCTCGAGATAAATCTGTAACTTCTTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-1193s1c1
Sequence:CCGGGCACACAATAGGTTAATCGAACTCGAGTTCGATTAACCTATTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006296.x-580s1c1
Sequence:CCGGGTTGGATGTACTGGAATATATCTCGAGATATATTCCAGTACATCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006296.x-723s1c1
Sequence:CCGGACCACAAACAGTATCAGGAAACTCGAGTTTCCTGATACTGTTTGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-390s21c1
Sequence:CCGGCTGGAGGATTTGGATTGATATCTCGAGATATCAATCCAAATCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-1189s21c1
Sequence:CCGGGCCAAACTATCAAGCCCTCAACTCGAGTTGAGGGCTTGATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-730s21c1
Sequence:CCGGGTTGGATGTACTGGAATATATCTCGAGATATATTCCAGTACATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006296.4-616s21c1
Sequence:CCGGGGGAAGAAGTTACAGATTTATCTCGAGATAAATCTGTAACTTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027260
VALIDATED
VRK2 MISSION shRNA Bacterial Glycerol Stock
vaccinia related kinase 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-1094s1c1
Sequence:CCGGCCAGCTAAGTTCCCAAAGAAACTCGAGTTTCTTTGGGAACTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027260.1-88s1c1
Sequence:CCGGTCTGGATGATATGGAAGGAAACTCGAGTTTCCTTCCATATCATCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-568s1c1
Sequence:CCGGCCGGGTTTATCTTGCAGACTACTCGAGTAGTCTGCAAGATAAACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-182s1c1
Sequence:CCGGCCAAACAAAGATGCAAGACATCTCGAGATGTCTTGCATCTTTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-533s1c1
Sequence:CCGGGCCGCAAATCTACTGTTGGATCTCGAGATCCAACAGTAGATTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-448s21c1
Sequence:CCGGGGAGGGTTTGGACTGATATACCTCGAGGTATATCAGTCCAAACCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-1402s21c1
Sequence:CCGGCCAGCTAAGTTCCCAAAGAAACTCGAGTTTCTTTGGGAACTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-876s21c1
Sequence:CCGGCCGGGTTTATCTTGCAGACTACTCGAGTAGTCTGCAAGATAAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-917s21c1
Sequence:CCGGGTCCCAATGGGAACCACAAACCTCGAGGTTTGTGGTTCCCATTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-841s21c1
Sequence:CCGGGCCGCAAATCTACTGTTGGATCTCGAGATCCAACAGTAGATTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027260.3-965s21c1
Sequence:CCGGATAATGGGACAATAGAGTTTACTCGAGTAAACTCTATTGTCCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-1206s21c1
Sequence:CCGGGTACTTGATGTATGTTCATAACTCGAGTTATGAACATACATCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-787s21c1
Sequence:CCGGCTGGATGTACTGGAATATATACTCGAGTATATATTCCAGTACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-818s21c1
Sequence:CCGGAGTATGTTCATGGTGATATAACTCGAGTTATATCACCATGAACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027260
VALIDATED
VRK2 MISSION shRNA shRNA Plasmid DNA
vaccinia related kinase 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-1094s1c1
Sequence:CCGGCCAGCTAAGTTCCCAAAGAAACTCGAGTTTCTTTGGGAACTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027260.1-88s1c1
Sequence:CCGGTCTGGATGATATGGAAGGAAACTCGAGTTTCCTTCCATATCATCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-568s1c1
Sequence:CCGGCCGGGTTTATCTTGCAGACTACTCGAGTAGTCTGCAAGATAAACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-182s1c1
Sequence:CCGGCCAAACAAAGATGCAAGACATCTCGAGATGTCTTGCATCTTTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-533s1c1
Sequence:CCGGGCCGCAAATCTACTGTTGGATCTCGAGATCCAACAGTAGATTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-448s21c1
Sequence:CCGGGGAGGGTTTGGACTGATATACCTCGAGGTATATCAGTCCAAACCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-1402s21c1
Sequence:CCGGCCAGCTAAGTTCCCAAAGAAACTCGAGTTTCTTTGGGAACTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-876s21c1
Sequence:CCGGCCGGGTTTATCTTGCAGACTACTCGAGTAGTCTGCAAGATAAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-917s21c1
Sequence:CCGGGTCCCAATGGGAACCACAAACCTCGAGGTTTGTGGTTCCCATTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-841s21c1
Sequence:CCGGGCCGCAAATCTACTGTTGGATCTCGAGATCCAACAGTAGATTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027260.3-965s21c1
Sequence:CCGGATAATGGGACAATAGAGTTTACTCGAGTAAACTCTATTGTCCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-1206s21c1
Sequence:CCGGGTACTTGATGTATGTTCATAACTCGAGTTATGAACATACATCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-787s21c1
Sequence:CCGGCTGGATGTACTGGAATATATACTCGAGTATATATTCCAGTACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-818s21c1
Sequence:CCGGAGTATGTTCATGGTGATATAACTCGAGTTATATCACCATGAACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027260
VALIDATED
VRK2 MISSION shRNA Lentiviral Transduction Particles
vaccinia related kinase 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-1094s1c1
Sequence:CCGGCCAGCTAAGTTCCCAAAGAAACTCGAGTTTCTTTGGGAACTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027260.1-88s1c1
Sequence:CCGGTCTGGATGATATGGAAGGAAACTCGAGTTTCCTTCCATATCATCCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-568s1c1
Sequence:CCGGCCGGGTTTATCTTGCAGACTACTCGAGTAGTCTGCAAGATAAACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-182s1c1
Sequence:CCGGCCAAACAAAGATGCAAGACATCTCGAGATGTCTTGCATCTTTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027260.1-533s1c1
Sequence:CCGGGCCGCAAATCTACTGTTGGATCTCGAGATCCAACAGTAGATTTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-448s21c1
Sequence:CCGGGGAGGGTTTGGACTGATATACCTCGAGGTATATCAGTCCAAACCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-1402s21c1
Sequence:CCGGCCAGCTAAGTTCCCAAAGAAACTCGAGTTTCTTTGGGAACTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-876s21c1
Sequence:CCGGCCGGGTTTATCTTGCAGACTACTCGAGTAGTCTGCAAGATAAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-917s21c1
Sequence:CCGGGTCCCAATGGGAACCACAAACCTCGAGGTTTGTGGTTCCCATTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-841s21c1
Sequence:CCGGGCCGCAAATCTACTGTTGGATCTCGAGATCCAACAGTAGATTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027260.3-965s21c1
Sequence:CCGGATAATGGGACAATAGAGTTTACTCGAGTAAACTCTATTGTCCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-1206s21c1
Sequence:CCGGGTACTTGATGTATGTTCATAACTCGAGTTATGAACATACATCAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-787s21c1
Sequence:CCGGCTGGATGTACTGGAATATATACTCGAGTATATATTCCAGTACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027260.3-818s21c1
Sequence:CCGGAGTATGTTCATGGTGATATAACTCGAGTTATATCACCATGAACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks