EMAIL THIS PAGE TO A FRIEND

VRK3

vaccinia related kinase 3

UniProtKB ID: Q8IV63, A6NEG5, A8KA53, Q502Y2, Q9P2V8
Gene ID:
Human(51231) Summary: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. In both human and mouse, this gene has substitutions at several residues within the ATP binding motifs that in other kinases have been shown to be required for catalysis. In vitro assays indicate the protein lacks phosphorylation activity. The protein, however, likely retains its substrate binding capability. This gene is widely expressed in human tissues and its protein localizes to the nucleus. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(101568) vaccinia related kinase 3
Rat(361565) vaccinia related kinase 3
Zebrafish(541443) vaccinia related kinase 3
chicken(770440) vaccinia related kinase 3
domestic cat(101092656) vaccinia related kinase 3
dog(484367) vaccinia related kinase 3
cow(520302) vaccinia related kinase 3
sheep(101109637) vaccinia related kinase 3
naked mole-rat(101705633) vaccinia related kinase 3
domestic guinea pig(100721045) vaccinia related kinase 3
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016440 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013641 MISSION® esiRNA esiRNA targeting human VRK3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025778 Rosetta Predictions human pricing
NM_016440 Rosetta Predictions human pricing
NM_001005561 Rosetta Predictions rat pricing
NM_133945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020631 predicted 928
2 SASI_Hs01_00020632 predicted 1011
3 SASI_Hs01_00020633 predicted 811
4 SASI_Hs01_00020634 predicted 1349
5 SASI_Hs01_00020635 predicted 1169
6 SASI_Hs01_00020636 predicted 1154
7 SASI_Hs01_00020637 predicted 814
8 SASI_Hs01_00020638 predicted 712
9 SASI_Hs01_00020640 predicted 1361
10 SASI_Hs02_00307487 predicted 929
11 SASI_Hs01_00020639 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132184 predicted 1077
2 SASI_Hs01_00132185 predicted 1163
3 SASI_Hs01_00132186 predicted 957
4 SASI_Hs01_00132187 predicted 1498
5 SASI_Hs01_00132188 predicted 1317
6 SASI_Hs01_00132189 predicted 1301
7 SASI_Hs01_00132190 predicted 973
8 SASI_Hs01_00132191 predicted 864
9 SASI_Hs01_00132193 predicted 1508
10 SASI_Hs02_00349469 predicted 1076
11 SASI_Hs01_00132192 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080556 predicted 324
2 SASI_Rn01_00080557 predicted 1384
3 SASI_Rn01_00080558 predicted 222
4 SASI_Rn01_00080559 predicted 949
5 SASI_Rn01_00080560 predicted 912
6 SASI_Rn01_00080561 predicted 562
7 SASI_Rn01_00080562 predicted 848
8 SASI_Rn01_00080563 predicted 1375
9 SASI_Rn01_00080564 predicted 558
10 SASI_Rn01_00080565 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034518 predicted 617
2 SASI_Mm02_00339051 predicted 1468
3 SASI_Mm01_00034519 predicted 837
4 SASI_Mm01_00034520 predicted 555
5 SASI_Mm01_00034521 predicted 666
6 SASI_Mm01_00034522 predicted 751
7 SASI_Mm01_00034523 predicted 770
8 SASI_Mm01_00034524 predicted 1189
9 SASI_Mm01_00034525 predicted 741
10 SASI_Mm02_00339052 predicted 956
11 SASI_Mm01_00034517 predicted 630
12 SASI_Mm01_00034526 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016440
VALIDATED
VRK3 MISSION shRNA Bacterial Glycerol Stock
vaccinia related kinase 3
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1909s21c1
Sequence:GTACCGGGATACTCATCAGTCCTGATTACTCGAGTAATCAGGACTGATGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-377s21c1
Sequence:CCGGAGTATCCAAGCGGCATTCAAACTCGAGTTTGAATGCCGCTTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-946s21c1
Sequence:CCGGCTCACTCAAACTGGATGCCAACTCGAGTTGGCATCCAGTTTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1872s21c1
Sequence:GTACCGGCAAGCCCTGGAATGTGCATTCCTCGAGGAATGCACATTCCAGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-1087s21c1
Sequence:CCGGCGGTGTTCACCAGGACAAATACTCGAGTATTTGTCCTGGTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-1021s21c1
Sequence:CCGGGCAAGTCAACAAGTGGAAGAACTCGAGTTCTTCCACTTGTTGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1831s21c1
Sequence:GTACCGGGACTCAAGGCCTGCTGTTTAACTCGAGTTAAACAGCAGGCCTTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1774s21c1
Sequence:GTACCGGGGAATCCAGAACTTTCCATTTCTCGAGAAATGGAAAGTTCTGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-753s1c1
Sequence:CCGGACTCAGGACCACAGAAGCAAACTCGAGTTTGCTTCTGTGGTCCTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-778s1c1
Sequence:CCGGCTCACTCAAACTGGATGCCAACTCGAGTTGGCATCCAGTTTGAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-354s1c1
Sequence:CCGGCTCCTAAGAAAGTGAAATGGTCTCGAGACCATTTCACTTTCTTAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-1553s1c1
Sequence:CCGGGATCTGCGTGTGTCTCCATATCTCGAGATATGGAGACACACGCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-641s1c1
Sequence:CCGGGACAACCAGGGCATTCTCTATCTCGAGATAGAGAATGCCCTGGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-793s1c1
Sequence:CCGGGCAAGTCAACAAGTGGAAGAACTCGAGTTCTTCCACTTGTTGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016440.x-1258s1c1
Sequence:CCGGGCTGAAGTGGCTCTACGGGTTCTCGAGAACCCGTAGAGCCACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016440.3-1895s1c1
Sequence:CCGGGCCACTGGTTTCAGGATACTCCTCGAGGAGTATCCTGAAACCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.3-1504s1c1
Sequence:CCGGGTTTCTGCCATGGACAAATTGCTCGAGCAATTTGTCCATGGCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016440.3-1530s1c1
Sequence:CCGGCCAACACTGAGGACATCATGACTCGAGTCATGATGTCCTCAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.3-404s1c1
Sequence:CCGGCCCTACTGTGGAAATTCTTTGCTCGAGCAAAGAATTTCCACAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.3-1409s1c1
Sequence:CCGGGAGTTCATTAGCATGGACCTGCTCGAGCAGGTCCATGCTAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016440
VALIDATED
VRK3 MISSION shRNA shRNA Plasmid DNA
vaccinia related kinase 3
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1909s21c1
Sequence:GTACCGGGATACTCATCAGTCCTGATTACTCGAGTAATCAGGACTGATGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-377s21c1
Sequence:CCGGAGTATCCAAGCGGCATTCAAACTCGAGTTTGAATGCCGCTTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-946s21c1
Sequence:CCGGCTCACTCAAACTGGATGCCAACTCGAGTTGGCATCCAGTTTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1872s21c1
Sequence:GTACCGGCAAGCCCTGGAATGTGCATTCCTCGAGGAATGCACATTCCAGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-1087s21c1
Sequence:CCGGCGGTGTTCACCAGGACAAATACTCGAGTATTTGTCCTGGTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-1021s21c1
Sequence:CCGGGCAAGTCAACAAGTGGAAGAACTCGAGTTCTTCCACTTGTTGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1831s21c1
Sequence:GTACCGGGACTCAAGGCCTGCTGTTTAACTCGAGTTAAACAGCAGGCCTTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1774s21c1
Sequence:GTACCGGGGAATCCAGAACTTTCCATTTCTCGAGAAATGGAAAGTTCTGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-753s1c1
Sequence:CCGGACTCAGGACCACAGAAGCAAACTCGAGTTTGCTTCTGTGGTCCTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-778s1c1
Sequence:CCGGCTCACTCAAACTGGATGCCAACTCGAGTTGGCATCCAGTTTGAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-354s1c1
Sequence:CCGGCTCCTAAGAAAGTGAAATGGTCTCGAGACCATTTCACTTTCTTAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-1553s1c1
Sequence:CCGGGATCTGCGTGTGTCTCCATATCTCGAGATATGGAGACACACGCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-641s1c1
Sequence:CCGGGACAACCAGGGCATTCTCTATCTCGAGATAGAGAATGCCCTGGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-793s1c1
Sequence:CCGGGCAAGTCAACAAGTGGAAGAACTCGAGTTCTTCCACTTGTTGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016440.x-1258s1c1
Sequence:CCGGGCTGAAGTGGCTCTACGGGTTCTCGAGAACCCGTAGAGCCACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016440.3-1895s1c1
Sequence:CCGGGCCACTGGTTTCAGGATACTCCTCGAGGAGTATCCTGAAACCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.3-1504s1c1
Sequence:CCGGGTTTCTGCCATGGACAAATTGCTCGAGCAATTTGTCCATGGCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016440.3-1530s1c1
Sequence:CCGGCCAACACTGAGGACATCATGACTCGAGTCATGATGTCCTCAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.3-404s1c1
Sequence:CCGGCCCTACTGTGGAAATTCTTTGCTCGAGCAAAGAATTTCCACAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.3-1409s1c1
Sequence:CCGGGAGTTCATTAGCATGGACCTGCTCGAGCAGGTCCATGCTAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016440
VALIDATED
VRK3 MISSION shRNA Lentiviral Transduction Particles
vaccinia related kinase 3
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1909s21c1
Sequence:GTACCGGGATACTCATCAGTCCTGATTACTCGAGTAATCAGGACTGATGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-377s21c1
Sequence:CCGGAGTATCCAAGCGGCATTCAAACTCGAGTTTGAATGCCGCTTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-946s21c1
Sequence:CCGGCTCACTCAAACTGGATGCCAACTCGAGTTGGCATCCAGTTTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1872s21c1
Sequence:GTACCGGCAAGCCCTGGAATGTGCATTCCTCGAGGAATGCACATTCCAGGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-1087s21c1
Sequence:CCGGCGGTGTTCACCAGGACAAATACTCGAGTATTTGTCCTGGTGAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016440.3-1021s21c1
Sequence:CCGGGCAAGTCAACAAGTGGAAGAACTCGAGTTCTTCCACTTGTTGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1831s21c1
Sequence:GTACCGGGACTCAAGGCCTGCTGTTTAACTCGAGTTAAACAGCAGGCCTTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016440.3-1774s21c1
Sequence:GTACCGGGGAATCCAGAACTTTCCATTTCTCGAGAAATGGAAAGTTCTGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-753s1c1
Sequence:CCGGACTCAGGACCACAGAAGCAAACTCGAGTTTGCTTCTGTGGTCCTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-778s1c1
Sequence:CCGGCTCACTCAAACTGGATGCCAACTCGAGTTGGCATCCAGTTTGAGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-354s1c1
Sequence:CCGGCTCCTAAGAAAGTGAAATGGTCTCGAGACCATTTCACTTTCTTAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-1553s1c1
Sequence:CCGGGATCTGCGTGTGTCTCCATATCTCGAGATATGGAGACACACGCAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-641s1c1
Sequence:CCGGGACAACCAGGGCATTCTCTATCTCGAGATAGAGAATGCCCTGGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.x-793s1c1
Sequence:CCGGGCAAGTCAACAAGTGGAAGAACTCGAGTTCTTCCACTTGTTGACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016440.x-1258s1c1
Sequence:CCGGGCTGAAGTGGCTCTACGGGTTCTCGAGAACCCGTAGAGCCACTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199854    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016440.3-1895s1c1
Sequence:CCGGGCCACTGGTTTCAGGATACTCCTCGAGGAGTATCCTGAAACCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.3-1504s1c1
Sequence:CCGGGTTTCTGCCATGGACAAATTGCTCGAGCAATTTGTCCATGGCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016440.3-1530s1c1
Sequence:CCGGCCAACACTGAGGACATCATGACTCGAGTCATGATGTCCTCAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.3-404s1c1
Sequence:CCGGCCCTACTGTGGAAATTCTTTGCTCGAGCAAAGAATTTCCACAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016440.3-1409s1c1
Sequence:CCGGGAGTTCATTAGCATGGACCTGCTCGAGCAGGTCCATGCTAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133945
VALIDATED
VRK3 MISSION shRNA Bacterial Glycerol Stock
vaccinia related kinase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-900s21c1
Sequence:CCGGGCTCTGGAGTATCTCCATGAACTCGAGTTCATGGAGATACTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-1324s21c1
Sequence:CCGGTGGTGATGGCCCTCAATTATGCTCGAGCATAATTGAGGGCCATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-1001s21c1
Sequence:CCGGCTATGGCTTCACCTACCGATACTCGAGTATCGGTAGGTGAAGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-948s21c1
Sequence:CCGGGCTGAGAATGTCTTTGTGAATCTCGAGATTCACAAAGACATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-1558s21c1
Sequence:CCGGCACCGCTCCCTTAGGACATATCTCGAGATATGTCCTAAGGGAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-948s1c1
Sequence:CCGGGCTGAGAATGTCTTTGTGAATCTCGAGATTCACAAAGACATTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-1001s1c1
Sequence:CCGGCTATGGCTTCACCTACCGATACTCGAGTATCGGTAGGTGAAGCCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-900s1c1
Sequence:CCGGGCTCTGGAGTATCTCCATGAACTCGAGTTCATGGAGATACTCCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-593s1c1
Sequence:CCGGCTCTGAATCAAGGACCCAGAACTCGAGTTCTGGGTCCTTGATTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-779s1c1
Sequence:CCGGCAAGTACAGGTTCCTAGTATTCTCGAGAATACTAGGAACCTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133945
VALIDATED
VRK3 MISSION shRNA shRNA Plasmid DNA
vaccinia related kinase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-900s21c1
Sequence:CCGGGCTCTGGAGTATCTCCATGAACTCGAGTTCATGGAGATACTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-1324s21c1
Sequence:CCGGTGGTGATGGCCCTCAATTATGCTCGAGCATAATTGAGGGCCATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-1001s21c1
Sequence:CCGGCTATGGCTTCACCTACCGATACTCGAGTATCGGTAGGTGAAGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-948s21c1
Sequence:CCGGGCTGAGAATGTCTTTGTGAATCTCGAGATTCACAAAGACATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-1558s21c1
Sequence:CCGGCACCGCTCCCTTAGGACATATCTCGAGATATGTCCTAAGGGAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-948s1c1
Sequence:CCGGGCTGAGAATGTCTTTGTGAATCTCGAGATTCACAAAGACATTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-1001s1c1
Sequence:CCGGCTATGGCTTCACCTACCGATACTCGAGTATCGGTAGGTGAAGCCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-900s1c1
Sequence:CCGGGCTCTGGAGTATCTCCATGAACTCGAGTTCATGGAGATACTCCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-593s1c1
Sequence:CCGGCTCTGAATCAAGGACCCAGAACTCGAGTTCTGGGTCCTTGATTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-779s1c1
Sequence:CCGGCAAGTACAGGTTCCTAGTATTCTCGAGAATACTAGGAACCTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133945
VALIDATED
VRK3 MISSION shRNA Lentiviral Transduction Particles
vaccinia related kinase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-900s21c1
Sequence:CCGGGCTCTGGAGTATCTCCATGAACTCGAGTTCATGGAGATACTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-1324s21c1
Sequence:CCGGTGGTGATGGCCCTCAATTATGCTCGAGCATAATTGAGGGCCATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-1001s21c1
Sequence:CCGGCTATGGCTTCACCTACCGATACTCGAGTATCGGTAGGTGAAGCCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-948s21c1
Sequence:CCGGGCTGAGAATGTCTTTGTGAATCTCGAGATTCACAAAGACATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133945.1-1558s21c1
Sequence:CCGGCACCGCTCCCTTAGGACATATCTCGAGATATGTCCTAAGGGAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-948s1c1
Sequence:CCGGGCTGAGAATGTCTTTGTGAATCTCGAGATTCACAAAGACATTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-1001s1c1
Sequence:CCGGCTATGGCTTCACCTACCGATACTCGAGTATCGGTAGGTGAAGCCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-900s1c1
Sequence:CCGGGCTCTGGAGTATCTCCATGAACTCGAGTTCATGGAGATACTCCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-593s1c1
Sequence:CCGGCTCTGAATCAAGGACCCAGAACTCGAGTTCTGGGTCCTTGATTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133945.1-779s1c1
Sequence:CCGGCAAGTACAGGTTCCTAGTATTCTCGAGAATACTAGGAACCTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks