EMAIL THIS PAGE TO A FRIEND

VRTN

vertebrae development associated

Synonyms: C14orf115 vertnin
UniProtKB ID: Q9H8Y1, Q9NVC7
Gene ID:
Mouse(432677) vertebrae development associated
Rat(679509) vertebrae development associated
Zebrafish(555269) vertebrae development homolog (pig)
chicken(423350) vertebrae development homolog (pig)
dog(490782) vertebrae development homolog (pig)
domestic cat(101093527) vertebrae development homolog (pig)
domestic guinea pig(100732761) vertebrae development associated
naked mole-rat(101701554) vertebrae development associated
cow(528708) vertebrae development homolog (pig)
sheep(101106594) vertebrae development homolog (pig)
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018228 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU200711 MISSION® esiRNA esiRNA targeting mouse Vrtn mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018228 Rosetta Predictions human pricing
XM_001059118 Rosetta Predictions rat pricing
NM_001033776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023221 predicted 2518
2 SASI_Hs01_00023222 predicted 2112
3 SASI_Hs01_00023225 predicted 1476
4 SASI_Hs01_00023226 predicted 2513
5 SASI_Hs01_00023227 predicted 389
6 SASI_Hs02_00351546 predicted 1223
7 SASI_Hs01_00023228 predicted 2405
8 SASI_Hs01_00023229 predicted 1371
9 SASI_Hs02_00351547 predicted 2409
10 SASI_Hs02_00351548 predicted 706
11 SASI_Hs01_00023220 predicted 1186
12 SASI_Hs01_00023223 predicted 2450
13 SASI_Hs01_00023224 predicted 2386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292044 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083676 predicted 1870
2 SASI_Mm02_00288975 predicted 1070
3 SASI_Mm01_00083677 predicted 474
4 SASI_Mm01_00083678 predicted 1323
5 SASI_Mm01_00083680 predicted 2236
6 SASI_Mm02_00288976 predicted 2012
7 SASI_Mm01_00083681 predicted 2352
8 SASI_Mm01_00083682 predicted 1078
9 SASI_Mm01_00083683 predicted 1239
10 SASI_Mm01_00083684 predicted 1252
11 SASI_Mm01_00083679 predicted 562
12 SASI_Mm01_00083685 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033776
VRTN MISSION shRNA Bacterial Glycerol Stock
vertebrae development associated
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033776.1-398s1c2
Sequence:CCGGGCACTATTATCTGCAGGGCATCTCGAGATGCCCTGCAGATAATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033776.1-1078s1c1
Sequence:CCGGCCCGTTCTACCTACTATGCTTCTCGAGAAGCATAGTAGGTAGAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033776.1-593s1c1
Sequence:CCGGCATCCTTGAATGCAACATCTACTCGAGTAGATGTTGCATTCAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-740s21c1
Sequence:CCGGCCTCTTCCGTCACCAGTATTTCTCGAGAAATACTGGTGACGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033776.1-2564s21c1
Sequence:CCGGTATCACAGCGTGACCATTATTCTCGAGAATAATGGTCACGCTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-1245s21c1
Sequence:CCGGATGTTGAGCCCTCCTAGTATGCTCGAGCATACTAGGAGGGCTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-635s21c1
Sequence:CCGGCATCAAGATCCGACCCTATTTCTCGAGAAATAGGGTCGGATCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-1075s21c1
Sequence:CCGGTCTCCCGTTCTACCTACTATGCTCGAGCATAGTAGGTAGAACGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033776
VRTN MISSION shRNA shRNA Plasmid DNA
vertebrae development associated
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033776.1-398s1c2
Sequence:CCGGGCACTATTATCTGCAGGGCATCTCGAGATGCCCTGCAGATAATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033776.1-1078s1c1
Sequence:CCGGCCCGTTCTACCTACTATGCTTCTCGAGAAGCATAGTAGGTAGAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033776.1-593s1c1
Sequence:CCGGCATCCTTGAATGCAACATCTACTCGAGTAGATGTTGCATTCAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-740s21c1
Sequence:CCGGCCTCTTCCGTCACCAGTATTTCTCGAGAAATACTGGTGACGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033776.1-2564s21c1
Sequence:CCGGTATCACAGCGTGACCATTATTCTCGAGAATAATGGTCACGCTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-1245s21c1
Sequence:CCGGATGTTGAGCCCTCCTAGTATGCTCGAGCATACTAGGAGGGCTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-635s21c1
Sequence:CCGGCATCAAGATCCGACCCTATTTCTCGAGAAATAGGGTCGGATCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-1075s21c1
Sequence:CCGGTCTCCCGTTCTACCTACTATGCTCGAGCATAGTAGGTAGAACGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033776
VRTN MISSION shRNA Lentiviral Transduction Particles
vertebrae development associated
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033776.1-398s1c2
Sequence:CCGGGCACTATTATCTGCAGGGCATCTCGAGATGCCCTGCAGATAATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033776.1-1078s1c1
Sequence:CCGGCCCGTTCTACCTACTATGCTTCTCGAGAAGCATAGTAGGTAGAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033776.1-593s1c1
Sequence:CCGGCATCCTTGAATGCAACATCTACTCGAGTAGATGTTGCATTCAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-740s21c1
Sequence:CCGGCCTCTTCCGTCACCAGTATTTCTCGAGAAATACTGGTGACGGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033776.1-2564s21c1
Sequence:CCGGTATCACAGCGTGACCATTATTCTCGAGAATAATGGTCACGCTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-1245s21c1
Sequence:CCGGATGTTGAGCCCTCCTAGTATGCTCGAGCATACTAGGAGGGCTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-635s21c1
Sequence:CCGGCATCAAGATCCGACCCTATTTCTCGAGAAATAGGGTCGGATCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033776.1-1075s21c1
Sequence:CCGGTCTCCCGTTCTACCTACTATGCTCGAGCATAGTAGGTAGAACGGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018228
VRTN MISSION shRNA Bacterial Glycerol Stock
vertebrae development associated
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018228.1-1376s1c1
Sequence:CCGGCATTGCATCTCCCTGAACACACTCGAGTGTGTTCAGGGAGATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018228.1-1359s1c1
Sequence:CCGGCCAAGTTGTACCTGGAGCATTCTCGAGAATGCTCCAGGTACAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018228.1-1177s1c1
Sequence:CCGGCTCAACCTACTATGTCTGGAACTCGAGTTCCAGACATAGTAGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018228.1-2677s1c1
Sequence:CCGGGCAGAACGTTATCTTCAGTTTCTCGAGAAACTGAAGATAACGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018228.1-1388s1c1
Sequence:CCGGCTGAACACACTGGTACCCTATCTCGAGATAGGGTACCAGTGTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018228.1-2080s1c1
Sequence:CCGGGATCGCTACCACGAAGTTCAACTCGAGTTGAACTTCGTGGTAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018228.1-1400s1c1
Sequence:CCGGGTACCCTATCGCTGCTTCAAACTCGAGTTTGAAGCAGCGATAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018228.2-883s21c1
Sequence:CCGGTCTTCCGCCACCAGTACTTTGCTCGAGCAAAGTACTGGTGGCGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018228.2-2526s21c1
Sequence:CCGGTCGTTGTTTGCTGGTCATATTCTCGAGAATATGACCAGCAAACAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018228.2-2206s21c1
Sequence:CCGGAGGAGTTCAGTGCCCTCTTTCCTCGAGGAAAGAGGGCACTGAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018228
VRTN MISSION shRNA shRNA Plasmid DNA
vertebrae development associated
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018228.1-1376s1c1
Sequence:CCGGCATTGCATCTCCCTGAACACACTCGAGTGTGTTCAGGGAGATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018228.1-1359s1c1
Sequence:CCGGCCAAGTTGTACCTGGAGCATTCTCGAGAATGCTCCAGGTACAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018228.1-1177s1c1
Sequence:CCGGCTCAACCTACTATGTCTGGAACTCGAGTTCCAGACATAGTAGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018228.1-2677s1c1
Sequence:CCGGGCAGAACGTTATCTTCAGTTTCTCGAGAAACTGAAGATAACGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018228.1-1388s1c1
Sequence:CCGGCTGAACACACTGGTACCCTATCTCGAGATAGGGTACCAGTGTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018228.1-2080s1c1
Sequence:CCGGGATCGCTACCACGAAGTTCAACTCGAGTTGAACTTCGTGGTAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018228.1-1400s1c1
Sequence:CCGGGTACCCTATCGCTGCTTCAAACTCGAGTTTGAAGCAGCGATAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018228.2-883s21c1
Sequence:CCGGTCTTCCGCCACCAGTACTTTGCTCGAGCAAAGTACTGGTGGCGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018228.2-2526s21c1
Sequence:CCGGTCGTTGTTTGCTGGTCATATTCTCGAGAATATGACCAGCAAACAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018228.2-2206s21c1
Sequence:CCGGAGGAGTTCAGTGCCCTCTTTCCTCGAGGAAAGAGGGCACTGAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018228
VRTN MISSION shRNA Lentiviral Transduction Particles
vertebrae development associated
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018228.1-1376s1c1
Sequence:CCGGCATTGCATCTCCCTGAACACACTCGAGTGTGTTCAGGGAGATGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018228.1-1359s1c1
Sequence:CCGGCCAAGTTGTACCTGGAGCATTCTCGAGAATGCTCCAGGTACAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018228.1-1177s1c1
Sequence:CCGGCTCAACCTACTATGTCTGGAACTCGAGTTCCAGACATAGTAGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018228.1-2677s1c1
Sequence:CCGGGCAGAACGTTATCTTCAGTTTCTCGAGAAACTGAAGATAACGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018228.1-1388s1c1
Sequence:CCGGCTGAACACACTGGTACCCTATCTCGAGATAGGGTACCAGTGTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018228.1-2080s1c1
Sequence:CCGGGATCGCTACCACGAAGTTCAACTCGAGTTGAACTTCGTGGTAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018228.1-1400s1c1
Sequence:CCGGGTACCCTATCGCTGCTTCAAACTCGAGTTTGAAGCAGCGATAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018228.2-883s21c1
Sequence:CCGGTCTTCCGCCACCAGTACTTTGCTCGAGCAAAGTACTGGTGGCGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018228.2-2526s21c1
Sequence:CCGGTCGTTGTTTGCTGGTCATATTCTCGAGAATATGACCAGCAAACAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018228.2-2206s21c1
Sequence:CCGGAGGAGTTCAGTGCCCTCTTTCCTCGAGGAAAGAGGGCACTGAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks